ID: 1184836897

View in Genome Browser
Species Human (GRCh38)
Location 22:47029256-47029278
Sequence GTCCCTGGGCCCCATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184836897_1184836908 12 Left 1184836897 22:47029256-47029278 CCCTTCCCATGGGGCCCAGGGAC 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1184836908 22:47029291-47029313 TACCCCTTCCCGTGGGGCCCGGG 0: 1
1: 1
2: 1
3: 18
4: 178
1184836897_1184836904 5 Left 1184836897 22:47029256-47029278 CCCTTCCCATGGGGCCCAGGGAC 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1184836904 22:47029284-47029306 GCTTCCATACCCCTTCCCGTGGG 0: 1
1: 2
2: 1
3: 8
4: 85
1184836897_1184836905 6 Left 1184836897 22:47029256-47029278 CCCTTCCCATGGGGCCCAGGGAC 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1184836905 22:47029285-47029307 CTTCCATACCCCTTCCCGTGGGG No data
1184836897_1184836903 4 Left 1184836897 22:47029256-47029278 CCCTTCCCATGGGGCCCAGGGAC 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1184836903 22:47029283-47029305 CGCTTCCATACCCCTTCCCGTGG 0: 1
1: 2
2: 0
3: 7
4: 97
1184836897_1184836907 11 Left 1184836897 22:47029256-47029278 CCCTTCCCATGGGGCCCAGGGAC 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1184836907 22:47029290-47029312 ATACCCCTTCCCGTGGGGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184836897 Original CRISPR GTCCCTGGGCCCCATGGGAA GGG (reversed) Intronic
900238415 1:1603394-1603416 GTCCCTGGGGACCTGGGGAATGG + Intergenic
900810838 1:4800346-4800368 GACCAGGGGCCCCATGGGAGGGG + Intergenic
901059881 1:6467088-6467110 GTCACTGGGCCCCAAAGCAAAGG + Exonic
901830511 1:11889128-11889150 GGCACTGGGCCCCATGGGGCTGG + Intergenic
901878999 1:12182945-12182967 CTCTCTGGGCCCCAAGAGAAGGG + Intronic
902228046 1:15009100-15009122 GCCCTTGGGCCCCCTGGGTAGGG - Intronic
903216157 1:21844353-21844375 GTATCTGGGCCCCAGGGGAAGGG - Intronic
903374853 1:22859370-22859392 GCCCCTGGGCCCCAGGGGGCTGG - Intronic
903778759 1:25808918-25808940 GCCCAGGGGCCCCATGGGGAGGG - Intronic
903930228 1:26857622-26857644 ATCCCTGGGCCCCAAAGTAAAGG - Intergenic
904082782 1:27882464-27882486 TGCCCTGGGCCCCATGGGCCTGG - Exonic
904291000 1:29485801-29485823 CTCCCTGGCCCTGATGGGAATGG - Intergenic
904601164 1:31673267-31673289 GTCCCAGGGGCTCCTGGGAAGGG - Intronic
904604514 1:31691433-31691455 CTCCCTGGACCCCCTGGGATAGG - Exonic
905794691 1:40809016-40809038 GTCACTGGGTCCCTTGGCAAGGG - Intronic
906476670 1:46173913-46173935 GTCCCAGGGCCGCAGGGGCAGGG + Intronic
907159152 1:52358625-52358647 GTCCCTGGGCAAGAAGGGAATGG - Intronic
907887560 1:58607236-58607258 CTCACTGGGGCCCTTGGGAAAGG - Intergenic
908794967 1:67821991-67822013 TTCCCTGGGCCACACTGGAAGGG + Intronic
909389172 1:75098678-75098700 TTCCTTGGGCCACATTGGAAAGG - Intergenic
909732577 1:78912957-78912979 GTCCCTTGTCCCCATTGTAATGG - Intronic
909759506 1:79270870-79270892 GACCCTGGGACCCTTGGCAAAGG + Intergenic
910369844 1:86503819-86503841 TTCCCTGGCCCCCTAGGGAAAGG + Intergenic
912260535 1:108107856-108107878 GTCCCTGGGCTTCCTGGGAGTGG - Intergenic
913521293 1:119647900-119647922 GGCCCTGCGCCCCAGGGGAGCGG + Intergenic
915300280 1:154947702-154947724 CTCCATGGGCCCTGTGGGAAAGG + Exonic
915655903 1:157360263-157360285 GTCCCTGGGCCAGCTGGGGAGGG - Intergenic
915673429 1:157509638-157509660 GTCCCTGGGCCAGCTGGGGAGGG + Intergenic
915934421 1:160082376-160082398 GTCCAAGAGCCCCATGGCAATGG - Intronic
917543024 1:175933944-175933966 CTCCATGGTTCCCATGGGAAAGG - Intergenic
920086285 1:203419960-203419982 GTCACTGGAGGCCATGGGAATGG + Intergenic
924506123 1:244685936-244685958 GGCCATGGGGCCCATGGGGATGG - Intronic
1065811869 10:29450257-29450279 CACCCCGGGCCCCATGAGAAAGG + Intergenic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1073254378 10:102141449-102141471 GGCCCTGGGCCCCATCCCAAGGG - Exonic
1073287379 10:102397022-102397044 GTCCTTGGGCCCCACAGAAACGG - Exonic
1073291654 10:102416343-102416365 CTCCCTGGGCCCCCAGTGAAGGG - Intronic
1075903874 10:126064288-126064310 GGCCCAGGGCTCCATGGGGAAGG - Intronic
1076373356 10:129968424-129968446 GACCCTGGGCCCCAGTGGGAAGG + Intergenic
1076664481 10:132078584-132078606 GTCCCTGGGCTCAGTGGGAAAGG - Intergenic
1076844064 10:133060507-133060529 ATCCCTGGGGCTCATGGGGAGGG - Intergenic
1077061635 11:620192-620214 GTCCCTGGGCCTCAGGGGGCCGG - Intronic
1077445632 11:2589315-2589337 GCCCCTGGGCTGCATGAGAAGGG - Intronic
1077470043 11:2753393-2753415 GTCCCTGATCCCCCTGAGAAAGG + Intronic
1078386565 11:10898325-10898347 GTGCCTTGGCCCCCAGGGAAGGG + Intergenic
1078848029 11:15139343-15139365 GGCCCTGGGCCCAGTGGGAGAGG + Intronic
1080612486 11:33916527-33916549 TTCCCTTGGCCCGAGGGGAAAGG + Intergenic
1081620339 11:44615543-44615565 GTCTCTGGGCCCCCTGAGCAGGG - Intronic
1082996649 11:59260928-59260950 TGCCCTGGGCCTCATGTGAATGG - Intergenic
1083334200 11:61913344-61913366 GGGCCTGGGCCACAGGGGAAGGG + Intronic
1083624928 11:64067531-64067553 GTCCCTGAGCCCCAGGGGGAGGG - Intronic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1083990431 11:66243096-66243118 TCCCCAGGGCCCCTTGGGAAAGG - Intronic
1084110422 11:67010669-67010691 GTCCCTAGGCAGCCTGGGAAAGG + Intronic
1084641790 11:70430603-70430625 GTCCCCAGACCCCATGGGGAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088509839 11:110562870-110562892 GTCCTTGGGCTTCATGGAAATGG + Intergenic
1088690435 11:112322103-112322125 GATCCTGGGCCCCATGTGACAGG - Intergenic
1089603463 11:119628528-119628550 GACCCTGGGCCCTCTGGGCAGGG + Intronic
1089741837 11:120589925-120589947 CTCCCTGGGCCTCAGGGGATTGG - Intronic
1091938006 12:4448815-4448837 GTCCCTAAGCCCCAAGAGAAGGG - Intergenic
1095831481 12:46591587-46591609 CTCGCTGGGCTCCATGGTAATGG + Intergenic
1095952716 12:47790359-47790381 GTCCCTGGGCCTCAAGGCTAGGG + Intronic
1097149933 12:56969204-56969226 GACCCTTAGCCTCATGGGAAGGG - Intergenic
1097150926 12:56979352-56979374 GACCCTGGGCCAGAAGGGAAAGG - Intergenic
1097175595 12:57141114-57141136 GGCACTGGGGTCCATGGGAATGG + Intronic
1097244692 12:57601005-57601027 GGCCCAGGGGCCGATGGGAATGG - Exonic
1101652122 12:106686865-106686887 GTACCTGGGCCACAAGGGGAGGG - Exonic
1101806971 12:108072554-108072576 ATCCCAGGGCCCCATGGGGAGGG - Intergenic
1102435437 12:112919145-112919167 GTGCTTGGGCACCTTGGGAAAGG + Intronic
1103200455 12:119083678-119083700 GTCCCTGGCCATCTTGGGAATGG - Intronic
1103320609 12:120090770-120090792 CTCCCAGGGCCCCATGGGGCTGG + Intronic
1103966789 12:124645149-124645171 GTCCATGAGCCCCTTGGGGATGG - Intergenic
1105706031 13:22967861-22967883 GTCCCTGGGAACCATGGGTCAGG - Intergenic
1105865415 13:24454472-24454494 GTCCCTGGGCCCCATCTGGAGGG + Intronic
1107929131 13:45292295-45292317 GACCCTGGGCCCAAGTGGAATGG + Intergenic
1112599172 13:100838552-100838574 AGCCCTGGACCCCATGGGCATGG + Intergenic
1116771490 14:49131714-49131736 CTCGCTGGGCTCCATGGGGATGG + Intergenic
1116934872 14:50729625-50729647 CTCCCTGGGCACCATCGGACAGG + Exonic
1116984422 14:51204067-51204089 ATGCCTTGGTCCCATGGGAAAGG + Intergenic
1121114083 14:91331424-91331446 GTCTCCAGGCCCCATGGGCAAGG + Intronic
1121909504 14:97776232-97776254 CACCATGGGCCCCATGGCAAGGG + Intergenic
1122231514 14:100308399-100308421 GTCCCTGGGGTCCTTGGGAAGGG + Intergenic
1122231882 14:100310228-100310250 GTCCCTGGGGTCCTTGGGAAGGG + Intergenic
1122236504 14:100333417-100333439 TGCCCTGGGCCTCATGTGAATGG + Intergenic
1122262474 14:100531206-100531228 ATCCCTGGGCTCCGTGGGAGGGG + Intergenic
1122413132 14:101536068-101536090 GGCCCTGGGATCCAGGGGAAAGG - Intergenic
1202898876 14_GL000194v1_random:24626-24648 GTCCCTGGGGCCCAGTGCAAGGG + Intergenic
1202899021 14_GL000194v1_random:25243-25265 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1128269800 15:66299113-66299135 ATGCCTGGGGCCCATGGGGAGGG + Intronic
1129257730 15:74343628-74343650 GGCCCTGGGACCCCTGGAAATGG - Intronic
1129515840 15:76156886-76156908 GGCCCTGGGGCTCATGGGGATGG + Intronic
1129778020 15:78249652-78249674 CTCTCTGGGCCTCATGGGCAGGG - Intergenic
1130316961 15:82804263-82804285 CTGCCTGGGCCCCCTGGGAGAGG - Intronic
1130966323 15:88700323-88700345 GTCCCTGGTAGCCATGGGCAGGG - Intergenic
1131550228 15:93350850-93350872 GTCTCTGGGCTCCTTGAGAAGGG - Intergenic
1131839987 15:96426782-96426804 GTTCCTGGGGTCCATGGTAAGGG + Intergenic
1132224734 15:100131742-100131764 TTCCCTGGGCCTCAGTGGAAAGG - Intronic
1133967111 16:10539469-10539491 GTTCCTGGGCCTCATGGGAATGG - Intronic
1134804953 16:17116283-17116305 GTCCCTGTTCTCCATGGGGATGG + Intronic
1136417896 16:30114519-30114541 GTCCCGAGGCCCCGTGGGGAGGG + Exonic
1138679826 16:58676508-58676530 GTCCCAGGGCCCTCTGGGATGGG + Intronic
1139203647 16:65004745-65004767 TTCCATGGGCACCATGAGAAGGG - Exonic
1139956916 16:70697588-70697610 GTCCCGGAGCCCCATGGGGCTGG + Intronic
1141689610 16:85588769-85588791 GTCCCCGGGCCCCCTGACAAAGG - Intergenic
1142232958 16:88908393-88908415 CTCCCCGGGGCCCATGGGAGAGG + Intronic
1142476836 17:193822-193844 GAGCCTGGGCTCCCTGGGAATGG - Intergenic
1142813485 17:2407656-2407678 GCCCCAGGGCCCACTGGGAAAGG + Intronic
1142888515 17:2928374-2928396 GCCCCTGGTCCTCCTGGGAATGG - Intronic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1144995207 17:19263326-19263348 ATCCCTGGGGCCCATGAGAGTGG + Intronic
1145304826 17:21668044-21668066 CACCCTGGGCCGCCTGGGAATGG + Intergenic
1146378966 17:32314582-32314604 CTCCCTGGGAGCCCTGGGAAGGG - Intronic
1146940312 17:36839682-36839704 GGCCCTGGCACCCATGGGAGTGG + Intergenic
1147996316 17:44362221-44362243 GTCCCTGCACCTCAGGGGAAGGG - Intronic
1148076794 17:44941761-44941783 GTCCCTGCTCCCCATGGGGAGGG + Intronic
1150220132 17:63491408-63491430 GTTCCTGAGCCCCACGGGCAAGG + Intronic
1151156328 17:72125408-72125430 CTGCCTGGGCCCCATGTGGAAGG + Exonic
1151171595 17:72250983-72251005 GTCCCAGAGACCCATGGAAAAGG + Intergenic
1151536390 17:74741210-74741232 CTACCTGGGCCCCTTTGGAAAGG + Intronic
1152790897 17:82278968-82278990 ACACCAGGGCCCCATGGGAAAGG - Intergenic
1157762668 18:50275773-50275795 GCCCCTGGCCCCCATGGGCTTGG - Intronic
1157973581 18:52299508-52299530 TGCCATGGGCCCCATGGAAATGG + Intergenic
1160425881 18:78778839-78778861 GTCCCTGGGACCCCTGGGCCCGG + Intergenic
1160797625 19:953169-953191 GTCCCAGGGCCACCTGGGAGTGG - Intronic
1161054385 19:2182715-2182737 GCACCTGCTCCCCATGGGAAGGG + Intronic
1161698466 19:5783002-5783024 CTCCCTGGGCCCCGGGGGAGTGG + Exonic
1162953402 19:14085255-14085277 GTCCCAGGTCCCCATGGGTAAGG - Intronic
1163104391 19:15115143-15115165 GTCACTGGGCCTCATGGGATAGG + Exonic
1163128089 19:15255272-15255294 GTGCTTGGGCCCCCTGGGCATGG - Intronic
1163234336 19:16022284-16022306 GGCCCTGGGTCCCATGGGCCAGG + Intergenic
1163262893 19:16201894-16201916 GTCCTTGGGAGCCATGGGGACGG + Intronic
1163282940 19:16328165-16328187 GTCCCTGAACCCCACTGGAAGGG + Intergenic
1165738819 19:38193783-38193805 GAGCCTGGGCCCCCTGGGACTGG + Intronic
1166113919 19:40641001-40641023 TGCCCAGGGCCCCATGTGAAGGG + Intergenic
1168273955 19:55265959-55265981 GACCCTGTGCTCCATGGGGATGG - Exonic
1168353354 19:55688517-55688539 GTCCCTGGGCCCCTGGGGGATGG - Intronic
1202647722 1_KI270706v1_random:157468-157490 GTCCCTGGGGCCCAGCGCAAGGG - Intergenic
925907668 2:8548869-8548891 CTCCCTGGGCCACATGGACAGGG + Intergenic
928362611 2:30678194-30678216 GTCCCTGGGTTCTATGGAAAGGG - Intergenic
930589942 2:53315449-53315471 AGACCTGGGCCCCATGGGAATGG - Intergenic
933573037 2:84036005-84036027 GTGCCTGGTCCCCATGAAAAGGG + Intergenic
935061798 2:99615157-99615179 GTCACTGGGCAGCATGGAAATGG + Intronic
935831306 2:107003395-107003417 GTCCCTGGACCTCGTGGGATGGG - Intergenic
938265224 2:129923422-129923444 GTCCCAGCGCCCCCTGGGGACGG - Intergenic
938489442 2:131754194-131754216 GTCCCTGGGGCCCAGCGCAAGGG - Intronic
939289069 2:140169686-140169708 ATCCTTGGGTCCCATGAGAATGG - Intergenic
940377757 2:152975789-152975811 GTACTTGGGCCCAATGTGAACGG - Intergenic
947043467 2:225950054-225950076 GTCCTTGGGCCCCTAGGCAATGG - Intergenic
947722455 2:232378277-232378299 GAGCCTGGGCCCTGTGGGAAAGG - Intergenic
947726795 2:232406388-232406410 GAGCCTGGGCCCGGTGGGAAAGG - Intergenic
947793164 2:232879161-232879183 GTCCCTGGGGGCCAGGGGCATGG + Exonic
948456181 2:238105664-238105686 GCCCCCGGGCCCCATGGGCCAGG - Intronic
948590745 2:239048037-239048059 ATCACTGGACCCCATGGGGACGG - Intergenic
1171768149 20:29301235-29301257 GTCGCTGGTCCCCACGGGAGCGG + Intergenic
1172039137 20:32031445-32031467 GGCCCCGGGCCCCAAGGGCAGGG - Exonic
1172426654 20:34860224-34860246 GTCCCTGGTCCCCAGGGGGAGGG + Intronic
1173275271 20:41574933-41574955 TTCCCTGGGCCACATGGAAAAGG - Intronic
1173540324 20:43846339-43846361 GCCCCTAGACCCCATGGAAAGGG - Intergenic
1174402883 20:50285389-50285411 GTCCCAGGACCCCGTGGGAGAGG - Intergenic
1174484234 20:50851357-50851379 GTCCCTGGGAGCCGTGGGGAGGG - Intronic
1175844497 20:62051440-62051462 GTCCCAGGGCCCTGTGGGGAGGG - Intronic
1176112532 20:63417120-63417142 ACCCCTGGCCCCCATGGGCACGG - Intronic
1176604129 21:8815263-8815285 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1176706775 21:10123847-10123869 GTCCCTGGGGCCCAGCGCAAGGG - Intergenic
1178244061 21:30935406-30935428 GTCCCTGTGCTCCATGTGCAAGG - Intergenic
1179181079 21:39045751-39045773 GTCCCTGGGTCTCAGGGGGAAGG + Intergenic
1179450714 21:41466627-41466649 CCCCCTGGGCCCCATGGTCATGG + Intronic
1179909647 21:44441110-44441132 GGCCCTGGGCCCCAGGAGCACGG - Intronic
1179982022 21:44900592-44900614 GTCCCTGAGACCCAGGGGAAAGG - Intronic
1180346413 22:11706841-11706863 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1180354183 22:11824994-11825016 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1180384061 22:12167332-12167354 GTCCCTGGGGCCCAGCGCAAGGG - Intergenic
1180972460 22:19822600-19822622 GTCCCAGAGCCCAGTGGGAAAGG - Intronic
1180982534 22:19885571-19885593 GGAGCTGGGCCCCATGGGCAGGG + Intronic
1181306578 22:21920547-21920569 CTCCCTCGGCCCCAAGGCAAGGG + Exonic
1181735090 22:24875093-24875115 TTCCTTGGGCCCCAAGGTAAGGG - Intronic
1182419630 22:30242667-30242689 GTCTCTGGTCCCCAGGGCAAGGG - Exonic
1184245019 22:43231466-43231488 GCCCGTGGGCCACCTGGGAAGGG + Intronic
1184836871 22:47029181-47029203 GTCCCCGGGCCCCATGGGGAGGG - Intronic
1184836897 22:47029256-47029278 GTCCCTGGGCCCCATGGGAAGGG - Intronic
1184836910 22:47029294-47029316 GTTCCCGGGCCCCACGGGAAGGG - Intronic
1184947691 22:47815822-47815844 GTCCCTGGGCCCCCTTTTAAAGG - Intergenic
1185329682 22:50246595-50246617 GTGCCTGGGCCCCAGGGTGACGG - Intronic
950647542 3:14386294-14386316 GCCTCTGGTCCCCATGGCAAGGG + Intergenic
950799582 3:15539320-15539342 TTCCCATGTCCCCATGGGAAGGG + Intergenic
952492165 3:33883077-33883099 GTTCCTGGGCCCCTTGGGCTTGG - Intergenic
952899065 3:38097701-38097723 GTCACTGGGCCACCTGGGGATGG - Intronic
956728834 3:72178116-72178138 TTCCCTGGGCCCCAGATGAACGG - Intergenic
961474150 3:127136437-127136459 GCCCGTGGGCCCCGTGGGAGGGG + Intergenic
962142465 3:132804980-132805002 GTCCATGGGAACTATGGGAAGGG - Intergenic
962990528 3:140573485-140573507 GTTGCTGGGCCTCAGGGGAAAGG - Exonic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
966854305 3:184183790-184183812 GCCCCTGGGCTCCCTGGGCAGGG + Exonic
967807792 3:193730749-193730771 GGCCATGGGCCCCATGAGGACGG - Intergenic
968594893 4:1477211-1477233 CTCCCTGGGCCCCTCGGGAGAGG - Intergenic
968728376 4:2258675-2258697 GTCCCTGGTCCCCATTGGTAAGG - Intronic
968879590 4:3292395-3292417 GTCCCGGGGCCCGGAGGGAACGG + Intergenic
973387033 4:49519596-49519618 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
973990841 4:56405512-56405534 ATCCCTGGACCCCCAGGGAAGGG + Intronic
975493112 4:75010351-75010373 CTCCCTTTTCCCCATGGGAATGG - Intronic
976226176 4:82797455-82797477 GTCCCTGGGGCCCAGGGGAAGGG + Intronic
977939712 4:102845276-102845298 GTCACTGGTCCCTATGGAAAAGG + Intronic
981526963 4:145716224-145716246 GTCCCAGGTCACCATGAGAAAGG - Intronic
982130378 4:152224041-152224063 GACCCTGGGTTCCATGGGAAAGG - Intergenic
985415282 4:189730380-189730402 TTCACTGGGCCCCATGGCACTGG + Intergenic
985709008 5:1417776-1417798 GTCCCTGGAGCCCATGGTACAGG + Intronic
985891171 5:2716071-2716093 GCCCCTGGGCCTCCTGGGCAGGG - Intergenic
985925467 5:3012730-3012752 GTGCTGGGGCTCCATGGGAAAGG - Intergenic
988639528 5:33026042-33026064 GTCCCTGGGCACAATGGGGTGGG + Intergenic
990351317 5:54919318-54919340 TTTCCTGGGCTCCATGGGAGTGG - Intergenic
994820456 5:104644305-104644327 GTCCCTCTGCCTCTTGGGAAGGG + Intergenic
996792978 5:127313153-127313175 GACCCTGGGGCTCTTGGGAAAGG + Intronic
997369402 5:133348514-133348536 GTCCCAGGATGCCATGGGAAAGG + Intronic
997633373 5:135386649-135386671 GTCTCTAGCCCCCATGGGAATGG + Intronic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
998459482 5:142299023-142299045 TTCCCTGAGTCACATGGGAAGGG + Intergenic
999047778 5:148487831-148487853 GTCCCTGCTCCCAAAGGGAAAGG + Intronic
999246243 5:150156216-150156238 CTCCCTGGGTGCCATGGCAAGGG - Intergenic
1001293929 5:170485639-170485661 CTCCCTGGCCCCTTTGGGAAGGG - Intronic
1002261259 5:177995397-177995419 GCCCTTGGGCCCCATGGGGATGG - Intronic
1002431217 5:179205180-179205202 GACCCTGGGCACCAGGAGAAAGG + Intronic
1004302679 6:14472803-14472825 GAGCCTGGGGGCCATGGGAAGGG - Intergenic
1005376300 6:25185960-25185982 CTTGCTGGGCTCCATGGGAATGG + Intergenic
1006875348 6:37290570-37290592 CAGCCAGGGCCCCATGGGAAAGG - Intronic
1011580764 6:88861399-88861421 GTGCATGAGCCCCATGGGGAAGG - Intronic
1012922431 6:105233930-105233952 CTTGCTGGGCTCCATGGGAATGG + Intergenic
1013355645 6:109343873-109343895 GTCCCTGAGCCCCAAAGGAGGGG + Intergenic
1013726028 6:113096965-113096987 GTCAGTGGGGACCATGGGAAGGG + Intergenic
1015274048 6:131366323-131366345 TACCCAGGTCCCCATGGGAATGG + Intergenic
1015806983 6:137119620-137119642 CTCCCTGGGCACCATAGCAAAGG + Intergenic
1016776890 6:147914235-147914257 TTCCCTGGGCCACATTAGAAGGG - Intergenic
1017545207 6:155443347-155443369 GTCCCTGGGCCTCCTCGGACTGG + Exonic
1017664427 6:156705834-156705856 GTCTCTGAGCTCCATGAGAATGG - Intergenic
1018172149 6:161151859-161151881 GACCCTGGGCCCCAGGGCCAAGG - Intronic
1019145410 6:169972560-169972582 GTCAGTGGCCACCATGGGAAAGG + Intergenic
1019178971 6:170175601-170175623 GGGCCTGGGCTCCATGGAAAGGG + Intergenic
1022268986 7:28787179-28787201 GCCACTGGGCCACATGGGGAGGG - Intronic
1023863493 7:44228392-44228414 GCTCCTGGGCACCATGGGCAGGG + Intronic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1029258649 7:99286528-99286550 GTTTCTGGGCCCCCTGGGATGGG - Intergenic
1029402281 7:100353647-100353669 GGCCCTGGGCCCCAAGGGTCAGG - Intronic
1030323258 7:108192195-108192217 TTCCTTAGGCCCCAGGGGAATGG + Intronic
1034222006 7:149454105-149454127 GTCCCTGGTTTCCATGGGTAAGG - Exonic
1034266297 7:149782687-149782709 GTCCTTGGGCCGCAGGGGTAGGG + Intergenic
1034270746 7:149802499-149802521 GTCCCTGGGTGCCATGCGGAAGG + Intergenic
1034996482 7:155580478-155580500 GTGCCTGGGCCTCTTTGGAAGGG - Intergenic
1035468357 7:159094159-159094181 GGCCCTGGCTCCCATGGGGATGG - Intronic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1036015310 8:4776504-4776526 GTCTCAGGGCCCCATAGGAATGG + Intronic
1036191924 8:6678503-6678525 ATGCCTGGGACCCAGGGGAAGGG + Intergenic
1037524717 8:19713551-19713573 GCCCCTGGATCCCATGTGAATGG + Intronic
1040414290 8:47182928-47182950 GTCCCTGGGCACTAAGGGACTGG - Intergenic
1048445927 8:134493301-134493323 GTCCCTGGGCCTGAGGGGAACGG + Intronic
1048613994 8:136054603-136054625 GTCCCTGGGCCGCAGAGGACAGG + Intergenic
1049209486 8:141378907-141378929 ACCCCTGGGCCCCTTGGTAAGGG - Intergenic
1049346892 8:142143992-142144014 GTCCCTGGGCCCCAGGGACCAGG + Intergenic
1049427226 8:142542855-142542877 GTCCCTGAGCCCCTTTGAAACGG - Intronic
1049587012 8:143436923-143436945 GTCCCAGGGCCCCAGGGTAGAGG + Intergenic
1049657549 8:143805428-143805450 GTCCCTGGCCCGCAGGTGAATGG - Exonic
1054324927 9:63708220-63708242 GTCCCTGGGGCCCAGCGCAAGGG - Intergenic
1054350941 9:64016413-64016435 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1055345058 9:75327073-75327095 CTTGCTGGGCTCCATGGGAATGG + Intergenic
1055640851 9:78317932-78317954 GGTCCTGGGCCCCATGAGCAGGG + Intronic
1056690181 9:88801567-88801589 GTCCCTGGGTCCCCTTGGAGAGG + Intergenic
1057028729 9:91757113-91757135 GGCCCTGGGGCACATGGGGAAGG + Intronic
1057208012 9:93184773-93184795 GTCTCTGGGGGCCCTGGGAAAGG - Intergenic
1058402844 9:104637160-104637182 GTGCCTCAGCCCCAGGGGAATGG + Intergenic
1060230924 9:121824702-121824724 GTCCCTGGGCTCTTCGGGAAAGG + Intronic
1060973336 9:127751432-127751454 CTTTCTGGGACCCATGGGAAAGG - Intronic
1061484024 9:130911398-130911420 GTCCCTGGCACCCTTGGGCAGGG + Intronic
1061873817 9:133534335-133534357 GTCCCTGGGGCTCCTGAGAATGG - Intronic
1061956900 9:133968530-133968552 GACCCTGGGGACCATGGGACTGG - Intronic
1062051296 9:134448428-134448450 GTCCCTGGGCACCCAGAGAAAGG - Intergenic
1062185589 9:135216508-135216530 GCTCCTGGGCCCCAAGGGAAGGG - Intergenic
1062230539 9:135479661-135479683 GTGGCTGGGCATCATGGGAATGG - Intronic
1062424281 9:136498815-136498837 GTCCCTGCGCCCCGTGGGTTTGG + Intronic
1062460937 9:136662323-136662345 GTCCCTGAGGCCCATGGTGAGGG - Intronic
1062609797 9:137368825-137368847 GGCCCTGCGCCCCATGGGCCTGG - Intronic
1203697668 Un_GL000214v1:113569-113591 GTCCCTGGGGCCCAGCGCAAGGG - Intergenic
1185620682 X:1451133-1451155 GTCCCAGGACCCCCTAGGAATGG - Intronic
1185731462 X:2465090-2465112 GTCCCTGGGCCGCATGCTTAGGG - Intronic
1186385944 X:9110286-9110308 GGCCCTGGGCCCCATCAAAAAGG - Intronic
1187025620 X:15433058-15433080 GTGCCTGGGCACCATGCAAATGG + Intronic
1190630395 X:52380543-52380565 TTCCATGGGCCCCCTGAGAATGG + Intergenic
1190844081 X:54174940-54174962 GTCCCTGGGCCTAATGACAAGGG + Intronic
1192382981 X:70636574-70636596 GTGCCTGGGTCCCCTGGGATAGG - Intronic
1192507633 X:71698620-71698642 TTCCCTGGCCCCCTAGGGAAAGG + Intergenic
1192519063 X:71782932-71782954 TTCCCTGGCCCCCTAGGGAAAGG - Intergenic
1193361709 X:80586801-80586823 CTTGCTGGGCTCCATGGGAATGG + Intergenic
1195443217 X:104921355-104921377 GTACCTCAGCCCCATGGCAATGG - Intronic
1198807135 X:140503944-140503966 GAGCCTGGGCCCCATGGGCTCGG - Exonic
1200056134 X:153462375-153462397 GTCCCTGGGGCGCAGGGGAGAGG - Intronic
1201151952 Y:11099457-11099479 GTCCCTGGGGCCCAGTGCAAGGG + Intergenic
1201152814 Y:11103025-11103047 GTCCCTGGGGCCCAGCGCAAGGG + Intergenic
1201979362 Y:19890880-19890902 CTTCCTGGGCTCCATGGGAGTGG + Intergenic