ID: 1184836910

View in Genome Browser
Species Human (GRCh38)
Location 22:47029294-47029316
Sequence GTTCCCGGGCCCCACGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184836910_1184836920 11 Left 1184836910 22:47029294-47029316 CCCTTCCCGTGGGGCCCGGGAAC No data
Right 1184836920 22:47029328-47029350 ATACCCCTCCCAATGGGGCCAGG 0: 1
1: 1
2: 0
3: 10
4: 98
1184836910_1184836916 4 Left 1184836910 22:47029294-47029316 CCCTTCCCGTGGGGCCCGGGAAC No data
Right 1184836916 22:47029321-47029343 CGCTTCCATACCCCTCCCAATGG No data
1184836910_1184836918 6 Left 1184836910 22:47029294-47029316 CCCTTCCCGTGGGGCCCGGGAAC No data
Right 1184836918 22:47029323-47029345 CTTCCATACCCCTCCCAATGGGG 0: 1
1: 1
2: 2
3: 10
4: 118
1184836910_1184836921 12 Left 1184836910 22:47029294-47029316 CCCTTCCCGTGGGGCCCGGGAAC No data
Right 1184836921 22:47029329-47029351 TACCCCTCCCAATGGGGCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 127
1184836910_1184836917 5 Left 1184836910 22:47029294-47029316 CCCTTCCCGTGGGGCCCGGGAAC No data
Right 1184836917 22:47029322-47029344 GCTTCCATACCCCTCCCAATGGG 0: 1
1: 1
2: 2
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184836910 Original CRISPR GTTCCCGGGCCCCACGGGAA GGG (reversed) Intronic
No off target data available for this crispr