ID: 1184836994

View in Genome Browser
Species Human (GRCh38)
Location 22:47029644-47029666
Sequence GCTTCTGGGGCGGGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184836980_1184836994 14 Left 1184836980 22:47029607-47029629 CCGGCAGCCTCGATCTTGGCCAA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 40
4: 545
1184836984_1184836994 -5 Left 1184836984 22:47029626-47029648 CCAAGGCTCCTGGCTGCCGCTTC 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 40
4: 545
1184836978_1184836994 18 Left 1184836978 22:47029603-47029625 CCTGCCGGCAGCCTCGATCTTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 40
4: 545
1184836982_1184836994 7 Left 1184836982 22:47029614-47029636 CCTCGATCTTGGCCAAGGCTCCT 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 40
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184836994 Original CRISPR GCTTCTGGGGCGGGGATGGC AGG Intronic
900289724 1:1918835-1918857 GGTTCTGGGGCGGGGGTCACCGG - Intronic
900375082 1:2350564-2350586 GTCCCTGGGGTGGGGATGGCTGG + Intronic
900577181 1:3389217-3389239 GCCTCTGGGGAGGTGCTGGCTGG - Intronic
900589925 1:3454933-3454955 GCTGCCGGGGCGGGGCTTGCGGG - Intronic
901019297 1:6247913-6247935 GCTGCTGGGGTGGGGGTGGGAGG - Exonic
901628399 1:10636242-10636264 GCTGCTGGGCCGGCGTTGGCAGG - Intergenic
901634281 1:10663417-10663439 TCCCCTGGGGCGGGGCTGGCGGG + Intronic
901678511 1:10900327-10900349 GTGTGTGTGGCGGGGATGGCAGG + Intergenic
901856678 1:12048943-12048965 GCTTCTGGGGAGGTCAAGGCAGG - Intergenic
902236429 1:15060350-15060372 ACTGCAGGGGCGGGGGTGGCGGG + Intronic
903166012 1:21520966-21520988 GCTGCAGGGGAGGGGATGGCAGG - Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
903273163 1:22204682-22204704 GCTTCTGGGGCTGGGTTGTTCGG + Intergenic
904294928 1:29513954-29513976 GCTTCTCGGGGATGGATGGCTGG + Intergenic
905449581 1:38047630-38047652 GCAGCTGGGGCTGGGACGGCGGG + Intergenic
905908877 1:41640261-41640283 GCTGCTGGGGCGGGGGTTGGGGG + Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906991739 1:50746808-50746830 GCCTCTGGGCCAGTGATGGCAGG - Intronic
907406898 1:54259161-54259183 TCTTCTGGGGCGGGGTAGGGGGG - Intronic
907417692 1:54325955-54325977 GCTGCTGGGTGGGGGGTGGCGGG - Intronic
907425283 1:54375630-54375652 GCTTCTGGAGGGGGACTGGCTGG - Intronic
907616813 1:55934336-55934358 GCTTCTGGGTCTGTGATGGGAGG + Intergenic
908361009 1:63368079-63368101 GGTTCTGGGATGGGGACGGCGGG + Intronic
908523400 1:64966157-64966179 GCGGCTCGGGCGGGGAAGGCGGG - Intronic
908640585 1:66218603-66218625 TCTTCTGGGCTGGGGGTGGCTGG - Intronic
909096056 1:71290701-71290723 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
909407874 1:75312496-75312518 ATATCTGGGGCGGGGATGGGGGG + Intronic
910423950 1:87100460-87100482 GCTTCTGGGCCTGTGATGGGAGG + Intronic
910842209 1:91571372-91571394 GCCTCTGGGCCTGGCATGGCTGG + Intergenic
911158008 1:94655465-94655487 GCAACTGGGGTGGGGATGGGGGG + Intergenic
911301491 1:96179786-96179808 GCTTCTGGGACTAGGCTGGCTGG - Intergenic
911790884 1:102014278-102014300 GCTTCTGGGGCTGTGATGAGAGG - Intergenic
914655906 1:149740512-149740534 GCTTCTGAGGCAGGCAAGGCGGG - Intergenic
915249853 1:154580171-154580193 TCTCCTGAGGCGGGGATGGCGGG + Intergenic
915333280 1:155126636-155126658 GCTCCTGGGGTGGAGAGGGCGGG - Intergenic
916515455 1:165512550-165512572 GCTTCAGGGGTAGGGATGGCAGG - Intergenic
916962284 1:169901359-169901381 GCTTGAGGGGCTGGGATGGGAGG - Intergenic
917755466 1:178094005-178094027 GCTTCTGAGGCGGCGGCGGCGGG + Intergenic
918423719 1:184387546-184387568 GCTGCTGGTGCGGGGCTGGCGGG + Intronic
918557627 1:185822288-185822310 GGTTGTGGGGCGGGGTGGGCAGG + Intronic
919371966 1:196739177-196739199 GCTTCTGGGCCTGTGATGGGTGG + Intronic
920190612 1:204191354-204191376 GCTTATTGGGCGGGGTTGGGGGG - Intronic
921736434 1:218633682-218633704 GCTCCTGGGGCGGGGAAGGGTGG - Intergenic
922462999 1:225827262-225827284 GCTGCTGGGGCGTGGTTTGCAGG + Intronic
922821327 1:228487601-228487623 GCTTCTGGGCCGAGGAGGACGGG + Exonic
924090424 1:240495676-240495698 GATTCTGGAGCCGGGATGCCTGG - Intronic
1063154008 10:3361830-3361852 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1063377477 10:5562615-5562637 GGTTCTGGGGTGGAGATGGAAGG - Intergenic
1064622678 10:17230402-17230424 CCCTCGGGGGCGGGGATGGCGGG + Intronic
1065101539 10:22336319-22336341 GCCTGCGGGGCGGGGGTGGCGGG - Intergenic
1067045189 10:42981447-42981469 GCTTCTGGAGCTGGGAGGCCGGG + Intergenic
1067711831 10:48656260-48656282 GCCTCTGGGGGGGGGGGGGCGGG + Intronic
1067711855 10:48656332-48656354 GCAGCCGGGTCGGGGATGGCCGG + Intergenic
1068175203 10:53448131-53448153 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1069047988 10:63763194-63763216 GCATCTTGGAAGGGGATGGCTGG + Intergenic
1069729887 10:70603618-70603640 GCTTCTGGGGTGGGGGCAGCTGG + Intergenic
1069760836 10:70809865-70809887 GCTTCTGGGGCTGGAATGTCAGG + Intergenic
1071486573 10:86106454-86106476 GCTTCAGGTGTGGGGATGGAGGG + Intronic
1071486610 10:86106578-86106600 GCTTCAGGTGCGGGGATGGGAGG + Intronic
1071579405 10:86756305-86756327 GCTTGTGGGGAGGGGCCGGCGGG + Intergenic
1072152327 10:92692590-92692612 GCTTCTGGGGTAGGGGTCGCCGG + Intronic
1073103749 10:101020675-101020697 TCTCCTGGGGAGGGGATGGTGGG + Exonic
1073250453 10:102117797-102117819 GCTTCTGGGGCTGGAATGGCTGG - Intronic
1073593730 10:104780010-104780032 GCTTATGGGGAGGGGAAGGGAGG + Intronic
1073880596 10:107975318-107975340 GCTTCTGGGTCTGTGATGGTAGG + Intergenic
1075794396 10:125108704-125108726 GCTTCTGGGGTGGGCTGGGCGGG + Intronic
1076055154 10:127366753-127366775 GCTTCTGGGATGGGGATGGTCGG + Intronic
1076805882 10:132858515-132858537 GCTGCTGTGGTGGGGACGGCTGG + Intronic
1077136728 11:1003262-1003284 GCTGCTGGTGGGTGGATGGCTGG + Intronic
1077353598 11:2104424-2104446 GCTTCTGGGGCGCGGAGGCAGGG + Intergenic
1077421742 11:2453731-2453753 GGTTCTGGGGAGGGGGTTGCTGG - Intronic
1077426264 11:2479633-2479655 GCCTCTGGGCCTGGGATGGGAGG + Intronic
1077787893 11:5404135-5404157 GCTTCTGGGTCGGGGGCGGGGGG + Intronic
1078301504 11:10135292-10135314 GCCTCTGGGTCTGTGATGGCAGG + Intronic
1078482167 11:11687307-11687329 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1078989822 11:16635677-16635699 GCTTCTGGGCCTGTGATGGGAGG - Intronic
1079657881 11:23004172-23004194 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1079673690 11:23199225-23199247 GCCTCTGGGGCTGTGATGGGAGG + Intergenic
1081804959 11:45885555-45885577 TCTCCGGGGGCGGGGCTGGCGGG + Intergenic
1081991362 11:47339370-47339392 GCATCTGGGGCTGGCCTGGCTGG + Exonic
1082782960 11:57301337-57301359 GCTCCTGGAGCTGGGATGGTGGG - Intronic
1082802467 11:57425085-57425107 GCTGTTGGGGCGGGGAGGGGGGG + Intronic
1082959546 11:58905690-58905712 GGTTCGGGGGAGGGGATCGCTGG + Intronic
1083482522 11:62958950-62958972 GGTTATGGGGCGGGGTTGGCGGG - Intronic
1083970462 11:66070897-66070919 GGCGCTGGGGCGGGGAGGGCTGG - Intronic
1084087539 11:66861509-66861531 TGTTCTGGGGCTGGGAGGGCAGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1085532994 11:77202731-77202753 GCTTCTGGGGCGGGGGGTGGGGG + Intronic
1086490528 11:87354115-87354137 GGGACTGGGGCGGGGAAGGCAGG + Intergenic
1087533706 11:99416390-99416412 GCTACTGGGGAGGCTATGGCAGG - Intronic
1090405508 11:126473734-126473756 GCTTCTGGGTCTGGGAGTGCAGG - Intronic
1090636952 11:128695143-128695165 GCGGCTGGGGTGGGAATGGCCGG - Intronic
1091310036 11:134566451-134566473 GCTGCTGGGGCTGGGATTGCAGG - Intergenic
1091464862 12:675142-675164 TTTTCTGGGGCGGGGGTGGGGGG - Intergenic
1094041040 12:26122325-26122347 GCCGCCGGGGCGGGGATGCCGGG + Exonic
1096149107 12:49297589-49297611 GCTGCTGGGGCGGGGCAGGGCGG + Intronic
1096469590 12:51867985-51868007 GCTTCTGGGCTGGGGTTGGAGGG - Intergenic
1097186130 12:57197465-57197487 GCATCTGGGGGAGGGATGGTTGG - Intronic
1100376051 12:94017386-94017408 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1101117868 12:101549498-101549520 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1102037845 12:109782454-109782476 GCTTGTGGAGCTGGGATGGGTGG - Intergenic
1103136638 12:118513337-118513359 GCAGCTGGGGTGGGGATGGAGGG + Intergenic
1103207686 12:119143146-119143168 GCTCCTGGGGCTGGGGAGGCAGG - Intronic
1103360908 12:120353115-120353137 GCTTCTGGGGAGGGGTTTGGGGG + Intronic
1103764095 12:123269678-123269700 GGCTCTGGGGCGGGGGAGGCGGG + Intronic
1103912303 12:124359261-124359283 GGTTCTGGGACAGGAATGGCAGG + Intronic
1103937027 12:124482336-124482358 CGTCCTGGGGCTGGGATGGCTGG - Intronic
1103962586 12:124618184-124618206 GCTTCAGAGGCAGGGCTGGCTGG + Intergenic
1104052503 12:125205610-125205632 GCAGCTGGGGCGGGCATGGCCGG + Intronic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104598306 12:130134680-130134702 GCTTCTGCAGCAGGGATAGCTGG - Intergenic
1104768697 12:131346616-131346638 GCTGCAGGGGAGGGGCTGGCGGG - Intergenic
1104878515 12:132053384-132053406 GCGGCTGGGGCGGGGGTGGCTGG - Exonic
1105407532 13:20144494-20144516 ACTTCTGGGGCAGGTAGGGCTGG - Intronic
1105824670 13:24111408-24111430 GTTTCTGGGGTGGGGGTGGCGGG - Intronic
1105894436 13:24706412-24706434 GCTTCTGCTGGGGGGATGTCCGG - Exonic
1106301941 13:28474656-28474678 GCTTGCGGGGAGGGGATGGAGGG + Intronic
1106929798 13:34652001-34652023 GCCTCTGGGTCTGTGATGGCAGG - Intergenic
1107038906 13:35928404-35928426 GCTTCTGGGTCCTGCATGGCTGG + Intronic
1109006298 13:56882343-56882365 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1109097843 13:58141622-58141644 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1109384439 13:61608361-61608383 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1110233081 13:73186650-73186672 GCTTGTGGGGCTGAGATGGGAGG + Intergenic
1111122824 13:83877676-83877698 GTTGCTGGGGCGGGGAGGGTGGG + Exonic
1111358734 13:87146073-87146095 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1112428068 13:99323052-99323074 GCTTCTGGGCGAGGGATGGTAGG + Intronic
1113634132 13:111908504-111908526 GTTTCCGGGGCAGGGAAGGCAGG - Intergenic
1113907563 13:113826859-113826881 GGTTCCGGGGCAGGGATGGGTGG - Intronic
1113962300 13:114132694-114132716 CCTGCAGGGGCGGGGTTGGCAGG + Intergenic
1114217197 14:20665676-20665698 GCTTCTGGGCCTGTGATGGATGG + Intergenic
1114431663 14:22666629-22666651 GCTTCTGGGCCTGTGATGGAAGG + Intergenic
1114626897 14:24136141-24136163 GGTAGTGGGGCGGGGAGGGCTGG - Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114866227 14:26598097-26598119 GCTTGTTGGGGGGGGCTGGCGGG + Intergenic
1115362968 14:32524328-32524350 AGTTCTGGGGTGGGGATGGCTGG + Intronic
1115528141 14:34301880-34301902 GGGGCTGGGGCTGGGATGGCTGG - Intronic
1117128069 14:52652884-52652906 GCTTCTTGGGCTGAGATGGGAGG + Intronic
1117478409 14:56119076-56119098 GCGTCCGGGCCGGGGAGGGCGGG + Intronic
1117555640 14:56880444-56880466 GTTGCTGGGGCTGGGATGGTGGG - Intergenic
1118630091 14:67695013-67695035 GGTACTGGGGCGGTGAGGGCTGG - Intronic
1119418678 14:74493440-74493462 GCTTCTGGGCCTGAGAGGGCTGG - Exonic
1120235067 14:81881391-81881413 GCTTCTGTAGCAGAGATGGCTGG + Intergenic
1120819106 14:88895482-88895504 AGTTCTGTGGCAGGGATGGCTGG + Intergenic
1121310300 14:92932145-92932167 GCTTCTGGGGTGAGGATGAGGGG + Intronic
1121611475 14:95283990-95284012 GCCTCTGGGGCTGTGATGGGAGG - Intronic
1121671234 14:95712118-95712140 GCTTTTGGGACTGGGATGGAGGG + Intronic
1122548496 14:102537996-102538018 GCTTCAGTGACAGGGATGGCTGG + Intergenic
1122771025 14:104097714-104097736 GCGTCTGGGGAGGGGCTGGGGGG - Intronic
1122979003 14:105182701-105182723 GCTACTGGGGCGGTGACAGCTGG - Intergenic
1123086375 14:105718937-105718959 GCTTGGGGGACGGGGATGCCAGG + Intergenic
1123158279 14:106251868-106251890 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1123189077 14:106550913-106550935 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1124339685 15:28882354-28882376 GTGTCTGGGGCGGGGGTGACAGG - Intergenic
1124631748 15:31341812-31341834 GCGCCTGGGGCTGGGATGCCAGG - Intronic
1124642198 15:31402614-31402636 GCTCCTGGCGGTGGGATGGCGGG - Intronic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125879969 15:43185360-43185382 GCCTCTGGGACGGGGCTGGACGG + Exonic
1126786221 15:52179698-52179720 ACTTCCCGGGCGGGGACGGCGGG - Intronic
1127342992 15:58066191-58066213 GGTCCTGGGACGGGGATGGGAGG - Exonic
1127652355 15:61021655-61021677 GCATCTGGTCCGGGGATTGCAGG - Intronic
1127693026 15:61415918-61415940 GCCTCTGGGGCTGTGATGGGAGG + Intergenic
1128226043 15:66001946-66001968 TCTTCTGGGTCAGGGCTGGCAGG + Intronic
1128688878 15:69707973-69707995 GCTTCTGGGCCTGTGATGGCAGG + Intergenic
1129167958 15:73789633-73789655 GCTTCTGGGAAGGCCATGGCTGG - Intergenic
1129387804 15:75205452-75205474 GCTCCTGGAGTGGGGATGGGTGG + Intronic
1129868465 15:78926097-78926119 GCTTCTGGGTTGGGGGTGGCTGG + Intronic
1129881242 15:79007661-79007683 GCTACTGGGGAGGGTAAGGCAGG - Intronic
1130979648 15:88803723-88803745 GCTCCTGGGGCCGGGAGGCCCGG - Exonic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132516831 16:369964-369986 GGTTGTGGGGCGGCGAGGGCTGG - Exonic
1132947239 16:2538263-2538285 GCGGCCGGGCCGGGGATGGCGGG + Intronic
1132968476 16:2673193-2673215 GCGGCCGGGCCGGGGATGGCGGG - Intergenic
1133060693 16:3172479-3172501 GTTTCTAGGGCGGGGAGGGGAGG - Intergenic
1133612013 16:7442248-7442270 GCTTCTCGCTTGGGGATGGCTGG - Intronic
1134451231 16:14364940-14364962 GCTTCTGGGCCAGGGAAGGCTGG + Intergenic
1136276627 16:29182686-29182708 CATTCTGGGGCTGGGCTGGCGGG + Intergenic
1136479720 16:30533985-30534007 GACTCAGGGGCGGGTATGGCAGG + Intronic
1136845650 16:33573772-33573794 GCTCCTGGGACGGGGCTGGGAGG - Intergenic
1138533520 16:57647683-57647705 GCTTGAGGGGAGGGGCTGGCTGG - Intronic
1138581782 16:57946323-57946345 GCTTTTGGGGCTGGGATTTCAGG - Intronic
1139446390 16:67001064-67001086 GGGCCTGGGGCGGGGATGGGGGG + Intronic
1139831151 16:69799324-69799346 GATTCTTGGGTGGGGATGGGAGG + Intronic
1139952577 16:70679402-70679424 ACTCCTGGGGCGGGGGTGCCTGG + Intronic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1140707381 16:77643360-77643382 GGATGTGGGGCGGGGGTGGCAGG + Intergenic
1140765534 16:78153596-78153618 GTTTGTGGGGCGGGGCTGGAGGG + Intronic
1141638642 16:85328888-85328910 GCTGCGGGGGCAGGGGTGGCAGG - Intergenic
1141639671 16:85333848-85333870 GCGTCTGGGTCAGGGAGGGCAGG - Intergenic
1141792102 16:86243829-86243851 CCTGCTGGGCTGGGGATGGCAGG + Intergenic
1141972793 16:87494242-87494264 GCGACTGGGGCGGGGAGGGGGGG - Intergenic
1142005428 16:87687556-87687578 GCCTCTGGGGCGGGGGCGGATGG - Intronic
1142101687 16:88275504-88275526 CCTTCCGGGGCGTTGATGGCGGG + Intergenic
1203107358 16_KI270728v1_random:1422425-1422447 GCTCCTGGGACGGGGCTGGGAGG - Intergenic
1142645319 17:1307900-1307922 GCATCAGGGGCGGGCACGGCAGG + Intergenic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1143712379 17:8743796-8743818 GCCTCTGGGGCAGGGATGCTGGG - Intronic
1143829528 17:9639894-9639916 GCTTCTTTGGCTGGGAAGGCAGG + Intronic
1143854351 17:9837677-9837699 GCTTCTGGGGCTGGTAGGGATGG - Intronic
1144661280 17:17072441-17072463 GGTTCTGGGGTGGGGGTGGGGGG + Intronic
1144729805 17:17519826-17519848 GCTCCCGGGGCAGGGCTGGCAGG + Intronic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1146059701 17:29598001-29598023 GCATCTGGGGCAGGGCTGGGAGG + Intronic
1146186894 17:30730029-30730051 GCTTCTGTGAGGGGGATGACAGG + Intergenic
1146357014 17:32142763-32142785 GCTGCAGGGGCAGGGAGGGCAGG - Intronic
1147119150 17:38325447-38325469 GATTCTTGGGCGGGGAGGGGTGG + Intergenic
1147583654 17:41640114-41640136 GGTTCTGAGGCAGAGATGGCAGG - Intergenic
1147659053 17:42107564-42107586 GCTTCGGGGCCGGGGATGATGGG - Intronic
1147896975 17:43757450-43757472 GGTTGTGAGGCGGGGAGGGCTGG + Intronic
1148048342 17:44757702-44757724 GCATCTGGGCCTGGCATGGCAGG + Intergenic
1148489514 17:48014100-48014122 GCCTCTGGGGAGGGTATGGGGGG + Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1148906425 17:50915239-50915261 CCTTCTGGGCTGGGCATGGCAGG + Intergenic
1149190088 17:54050632-54050654 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1149660237 17:58331008-58331030 TCTTTGGGGGCGGGGAGGGCTGG - Intergenic
1150132211 17:62675327-62675349 GCTCCTGGCCCGGGGATGGCAGG - Intronic
1151415582 17:73960594-73960616 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1152733180 17:81983468-81983490 GATGGTGGGACGGGGATGGCGGG + Intronic
1152782368 17:82231955-82231977 GCGCCTGGGGCGGGGCTGCCGGG + Intronic
1153076335 18:1165550-1165572 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1153136863 18:1927322-1927344 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
1153636383 18:7117261-7117283 GCTGCGCGGGCGGGGGTGGCGGG - Intronic
1153907648 18:9677285-9677307 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1155134502 18:22975521-22975543 GCTTCTGGGACAGGGCTGGAAGG - Intronic
1155324055 18:24648364-24648386 ATTTCTGGGGTGGGGATGGAGGG + Intergenic
1155394476 18:25372504-25372526 TCTTTTGGGGTGGGGGTGGCCGG - Intergenic
1155928917 18:31685511-31685533 GTTTCGGGCGCGGGGAGGGCGGG - Intronic
1156899486 18:42284485-42284507 GTTTCTGTGGAGGGCATGGCTGG + Intergenic
1158424524 18:57327149-57327171 GCCTCAGGGGGGGAGATGGCAGG - Intergenic
1158727213 18:59984456-59984478 GCTTTTGGGGCGGGGGGGGGGGG - Intergenic
1159617489 18:70598493-70598515 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
1160044116 18:75371034-75371056 GCTTCTGGGTCGGGGAAGCAAGG - Intergenic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160460886 18:79037299-79037321 GCTTCTGGAGCCAGGATGCCTGG - Intergenic
1160460904 18:79037375-79037397 GCTTCTGGAGCCAGGATGCCTGG - Intergenic
1160460975 18:79037677-79037699 GCTTCTGGAGCCAGGATGCCTGG - Intergenic
1160505212 18:79423022-79423044 GCTGCTGGGCCTGGGATGGCAGG + Intronic
1160601395 18:80015113-80015135 GCTTCTGGGTCTGTGATGGCAGG + Intronic
1160831261 19:1105835-1105857 GCTGCTGGGGTGGGGGTGGGGGG + Intronic
1160836625 19:1127562-1127584 GCTGGTGGGTCGGGGCTGGCTGG + Intronic
1160841197 19:1147698-1147720 GCTGATGGAGCGGGGAGGGCGGG - Intronic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161102351 19:2427398-2427420 GCTGCAGGTGCGGGGCTGGCCGG - Exonic
1161186809 19:2926759-2926781 GCTTCGGGGTCTGGTATGGCTGG - Intergenic
1161266440 19:3366771-3366793 GCATCCCGGGCAGGGATGGCGGG - Intronic
1161400594 19:4065199-4065221 GCTTTGGGGGCGCGGACGGCGGG + Intronic
1161438580 19:4278576-4278598 GCTTCTGGGGGCGGGGTGGGGGG - Intergenic
1161461427 19:4400122-4400144 GCTTCTGGAGCCCGCATGGCGGG + Intronic
1161500199 19:4610292-4610314 GCTTCTGCGGCGGGGAGGGGGGG + Intergenic
1161648219 19:5467481-5467503 GCTGCTGCTGCGGGGGTGGCAGG + Intergenic
1161915529 19:7225381-7225403 GGTGGTGGGGCGGGGGTGGCGGG - Intronic
1162070544 19:8149653-8149675 GCTCCCGGGGCGGGGACGGGGGG + Exonic
1162445533 19:10720077-10720099 GCTTCTGGGACGGGGGTGGGGGG + Intronic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1163032656 19:14554409-14554431 TCTTCTGGGGCTGAGAGGGCAGG + Intronic
1163122386 19:15225823-15225845 CCCTCTGGGGTGGGGATGGGTGG - Intergenic
1163390236 19:17026494-17026516 CCTTCTGGGGTGGGGGTCGCGGG - Intronic
1164672069 19:30077881-30077903 CCATCTGGGGCCGGGATGCCTGG + Intergenic
1165423468 19:35733311-35733333 GCGTCAGGGGAGGGGGTGGCGGG - Exonic
1166276452 19:41757421-41757443 GCCTCTTGGGCAGGGCTGGCTGG + Intronic
1166524960 19:43504896-43504918 GCCGGTGGGGCCGGGATGGCCGG - Exonic
1166777483 19:45321981-45322003 GCAGCTGGGGGTGGGATGGCAGG - Intronic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
1167236843 19:48320613-48320635 GATTCTGGCGCGGGTTTGGCAGG + Intronic
1167577152 19:50323191-50323213 GCGGGTGGGGCGGGGGTGGCGGG + Exonic
1168108935 19:54181132-54181154 GCCTGTGGGGCGGGGAGGGAGGG + Exonic
1168669334 19:58229135-58229157 GCCTCAGGGACGGGGAAGGCCGG + Intronic
925131365 2:1496335-1496357 GCTCCTGGGGCGGGGCGGGGCGG + Intronic
925367069 2:3317870-3317892 GCTTCAGGGTCAGGCATGGCAGG - Intronic
925453399 2:3990907-3990929 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
926177318 2:10606124-10606146 CCTGCAGGGGCTGGGATGGCTGG + Intronic
927882317 2:26697512-26697534 GCTTCTGGGGAGGGCTTTGCTGG - Intronic
928245333 2:29621771-29621793 GCTTCTGGAGAGGTGAGGGCTGG + Intronic
929819782 2:45263794-45263816 GCTTCTGGGGCAGGGAATCCTGG + Intergenic
932288302 2:70554376-70554398 ATCTCTGGGGCGGGGAAGGCTGG + Intergenic
932428342 2:71657840-71657862 GCTTCTGGGCCTGTGATGGGAGG + Intronic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
933695712 2:85215751-85215773 GCTGCTGGGGTGGGGGTGGGGGG + Intronic
933749781 2:85595889-85595911 GTTTCTGGGCTGGGGCTGGCTGG + Intronic
933876020 2:86623023-86623045 GCTTCCCCGCCGGGGATGGCCGG - Exonic
934071209 2:88385285-88385307 GCTTCTGTGAAGGGGCTGGCGGG - Intergenic
934244071 2:90293164-90293186 GCTTGGCGGGCGTGGATGGCTGG - Intergenic
936622904 2:114118722-114118744 GATGGTGGGGCGGGGATGGAAGG + Intergenic
937047172 2:118857950-118857972 GCTTCTGGGGCGCAGAACGCTGG + Intergenic
937793920 2:125994649-125994671 GCTTCTGGAAAGGGGATGGTAGG - Intergenic
937974727 2:127575649-127575671 GGTTCTGGGGCGGGGAGGAGGGG + Intronic
937979726 2:127607846-127607868 ATTTCTGGGGCAGGGATGGTTGG + Intronic
938051383 2:128175743-128175765 GCTCCTGGGAAGGGGAGGGCTGG - Intronic
938472320 2:131576058-131576080 GCTGCCGGGGCGGGGATGGGGGG - Intergenic
941057767 2:160807880-160807902 GCCTCTGGGTCTGAGATGGCAGG + Intergenic
942138334 2:172951873-172951895 GATGTTGGGGCAGGGATGGCAGG + Intronic
944101408 2:196031347-196031369 GCTTCTGGGCCTGTGATGGGAGG + Intronic
945649123 2:212538032-212538054 GGTCCTGGGGCGGTGCTGGCTGG - Intronic
947181229 2:227413203-227413225 GACTGTGGGGCGGGGAGGGCAGG + Intergenic
947372155 2:229458022-229458044 GCTACTGGGGCGGCTAAGGCAGG + Intronic
948674184 2:239587478-239587500 GAGACTGCGGCGGGGATGGCAGG + Intergenic
948857149 2:240735496-240735518 GCTCCTGGGGTGGGGTGGGCAGG - Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1169145480 20:3249238-3249260 GCTCCTGGGGCGGGGGTGACGGG - Intergenic
1172097286 20:32466642-32466664 GCTCCTGGGGTGGGGGTGGGTGG + Intronic
1172101107 20:32484206-32484228 ACTTGTGGGGCGGGGCTGCCGGG + Intronic
1172108068 20:32528420-32528442 GCTGCTGGAGTGGGGAGGGCAGG - Intronic
1172229730 20:33328596-33328618 GCTTCGGGGGAGGTGATGCCAGG + Intergenic
1173151037 20:40566609-40566631 GTTACAGGGGAGGGGATGGCAGG - Intergenic
1173591800 20:44230642-44230664 GCTACTGGGGAGGCTATGGCAGG + Intergenic
1173686912 20:44930415-44930437 GCTGCTGGGGTGGGGAAGGAAGG - Intronic
1173859612 20:46274271-46274293 CTTTCTGGGGCTGGGAAGGCTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174064492 20:47854727-47854749 GCTTCTGGGGCTGCAAAGGCTGG + Intergenic
1175867546 20:62188345-62188367 GCTTCTGTGGTGGGGCTGGGGGG - Intronic
1175938010 20:62523836-62523858 GCTTCTCTGGCAGGCATGGCGGG + Intergenic
1175984307 20:62756290-62756312 GCTGCAGGCGAGGGGATGGCTGG + Intronic
1176124974 20:63471352-63471374 CCTCCTGGGGCAGGGCTGGCGGG - Intronic
1176194750 20:63831775-63831797 GCGTCAGGCGCGGGGACGGCCGG - Intergenic
1176230628 20:64030995-64031017 GCTGCTGGAGAAGGGATGGCGGG - Intronic
1176326245 21:5503757-5503779 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176389945 21:6158289-6158311 CCTTCTGGGGCTGGGAGGTCAGG - Intergenic
1176401512 21:6317194-6317216 GCTTCTGGGGAGGCTAAGGCAGG + Intergenic
1176435645 21:6671910-6671932 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176459907 21:6998980-6999002 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176483468 21:7380758-7380780 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1178099630 21:29253431-29253453 GCTTCTGGGTCTGCGATGGGAGG + Intronic
1178218296 21:30625662-30625684 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179733521 21:43379951-43379973 CCTTCTGGGGCTGGGAGGTCAGG + Intergenic
1179955032 21:44733869-44733891 GCTCCAGGGGCAGGGAGGGCAGG - Intergenic
1180192706 21:46173743-46173765 GCAGCTGGGGTGGGGATGGGGGG - Intronic
1180193193 21:46178773-46178795 GCTACTGGGGAGGGCAAGGCAGG + Intronic
1180981990 22:19882890-19882912 GATACTGAGGCGGGGAGGGCGGG + Intronic
1181068957 22:20320629-20320651 GCTGCTGGGCCGGGGCTGGGGGG + Intergenic
1181248409 22:21517291-21517313 CCTTGTGGGGCGGGGGTCGCGGG - Intergenic
1182026707 22:27124740-27124762 TCTTCTGTGGCGAGGGTGGCAGG + Intergenic
1183334508 22:37238985-37239007 GCTTCTGGGCTGAGGATGGTAGG - Intronic
1183411157 22:37655641-37655663 GCTCCTGGGGCGGGGCTGAGGGG - Exonic
1183665081 22:39242432-39242454 GCTGTTGGGGAGGGGGTGGCCGG - Intronic
1183924859 22:41198352-41198374 GCTACTGGGGCGGGGTTTGGGGG + Intergenic
1183928223 22:41220998-41221020 GCCTCTGGGATGGGGAGGGCAGG - Intronic
1184770444 22:46594104-46594126 GATGCTGGGGAGGGGCTGGCAGG - Intronic
1184770452 22:46594126-46594148 GATGCTGGGGTGGGGCTGGCAGG - Intronic
1184770460 22:46594148-46594170 GCAGCTGGGGAGGGGCTGGCGGG - Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1185013722 22:48331571-48331593 GCTTCTGGCACGGGGAAGGCAGG - Intergenic
1185074027 22:48673546-48673568 TCTTCTGAGGGTGGGATGGCTGG + Intronic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
1185292815 22:50035635-50035657 GCTTCAGGGGCGCGGGGGGCTGG - Intronic
1185298865 22:50068626-50068648 GCTGGGGGGGCGGGCATGGCCGG + Intronic
1185316691 22:50182403-50182425 GCTGCTGGGGCAGGGAGGACAGG - Intergenic
1185320442 22:50198204-50198226 GCTTGTGGGGTGGGGCTTGCAGG - Intronic
1185367584 22:50443996-50444018 ACTGCTGGGGTGGGTATGGCGGG - Exonic
949612255 3:5715045-5715067 GCCTCTGGGCCTGGGATGGGAGG - Intergenic
950193618 3:10993961-10993983 GCTGGGGGGGCGGGGAGGGCGGG + Intronic
950472680 3:13196279-13196301 GCTTCAGGTGCCTGGATGGCTGG - Intergenic
950589269 3:13924638-13924660 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
950637378 3:14324475-14324497 GCTTTTGGGGCTGGGGTGTCTGG - Intergenic
952904510 3:38130945-38130967 GCATCTGGTGCTGGGAGGGCAGG - Intronic
952934298 3:38383662-38383684 GCTACTGGGGGTGGGGTGGCAGG + Intronic
953027562 3:39153688-39153710 GCCTCCGGGGCGGGGCTGCCGGG - Intronic
953419997 3:42747024-42747046 GCTGCGGGGGTGGGGGTGGCAGG + Intronic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
953924558 3:46975955-46975977 GCTTCTCGGGAGGCTATGGCAGG - Intronic
955395555 3:58554594-58554616 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
957981683 3:87519425-87519447 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
959606247 3:108244851-108244873 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
961313756 3:126020287-126020309 GCTTCTGGGCCTGTGATGGGAGG + Intronic
962006757 3:131357243-131357265 GCTACTGGGGAGGGCAAGGCAGG + Intergenic
962250559 3:133833553-133833575 GCTGCTGGGGCAGGGCGGGCAGG - Intronic
962389938 3:134962834-134962856 GCTGCTGGGGAAGGGGTGGCAGG - Intronic
962846382 3:139277947-139277969 TCCTATGGGGCAGGGATGGCAGG - Intronic
964129337 3:153269100-153269122 GCACCTGGGGCGGGACTGGCGGG + Intergenic
964281348 3:155069912-155069934 GCTTCTGGGGCTGGGTAGGGAGG - Intronic
967777065 3:193395564-193395586 GCCTCTGGGCCTGTGATGGCAGG + Intergenic
967857804 3:194131441-194131463 CCTTCCGGGGCGGGGGTGGGGGG + Intergenic
968652763 4:1766731-1766753 ACCCCTGAGGCGGGGATGGCCGG - Intergenic
968688364 4:1976578-1976600 GCTTCCGCTGCGGTGATGGCGGG + Exonic
968764795 4:2462689-2462711 CGTCCCGGGGCGGGGATGGCGGG + Intronic
968775360 4:2536763-2536785 GCGTCCGGGTCGGGGAGGGCTGG - Intronic
968934628 4:3603583-3603605 GCTTGTGGGGCTGGGAAGTCAGG + Intergenic
969240409 4:5893204-5893226 GCGGCTGGGGCGGGGAGGGACGG + Intergenic
969244443 4:5923448-5923470 GCTTTTGTGGCGGGGGCGGCTGG + Intronic
969551207 4:7868651-7868673 GCATCTGAGGAGGGGCTGGCAGG + Exonic
969697141 4:8741213-8741235 GCTTCCGGGGCTGGCAGGGCAGG - Intergenic
969837836 4:9857870-9857892 GCTTCAGTGGAGGGGATAGCAGG - Intronic
970218107 4:13779973-13779995 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
970635565 4:18005845-18005867 GCCTCTGGGCCTGTGATGGCAGG + Intronic
971231097 4:24800546-24800568 GCTTATGGGGTGGGGAAGGAGGG - Exonic
971351939 4:25862995-25863017 GCTGCGGGGGCGGCGACGGCGGG - Intronic
971457453 4:26858085-26858107 CCTTGTGGGGCGGGCATGGTTGG + Intronic
972132744 4:35858786-35858808 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
972242125 4:37204323-37204345 ACTTCTGGGGCTGTGATGGGAGG + Intergenic
974267432 4:59603430-59603452 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
975214508 4:71738152-71738174 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977339815 4:95744205-95744227 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
979137460 4:117127798-117127820 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
979438754 4:120726066-120726088 GCTACAGGGGCAGGGATGGAGGG + Intronic
980586076 4:134817400-134817422 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
983419655 4:167501024-167501046 GCTTCTGGGTCTGTGATGGAAGG + Intergenic
984189786 4:176592040-176592062 GCATTTGGGGTGGGGGTGGCAGG - Intergenic
984189897 4:176592924-176592946 GCATTTGGGGTGGGGGTGGCAGG + Intergenic
984512316 4:180693622-180693644 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
984767108 4:183408202-183408224 GCCTCTGGGGGGGAGATGCCAGG + Intergenic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985570410 5:641731-641753 GCTTCTGGATGGGGGATGGGGGG - Intronic
985688372 5:1294041-1294063 GCTTCTTCGGCGGGTCTGGCAGG + Exonic
985788138 5:1910675-1910697 GCTGCCGGGGCGGGCCTGGCTGG - Intergenic
986457071 5:7930469-7930491 ACTCCTGGGGCGGGGATGAGGGG - Intergenic
987097978 5:14566660-14566682 GCTTCTGGGTCTGTGATGGGAGG + Intergenic
987514588 5:18888986-18889008 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
987723137 5:21663795-21663817 GCTTCTGGGCCTGTGATGGAAGG + Intergenic
987884822 5:23800086-23800108 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
989056312 5:37369138-37369160 GCTACTGGGGAGGGCAAGGCGGG + Intronic
989188761 5:38649673-38649695 TTTTCTGGGGGGGGGATGGGGGG - Intergenic
989229754 5:39073673-39073695 GCTCCGGGGACGGGGAGGGCAGG + Intronic
989565723 5:42899083-42899105 GCTTCCGGGGCGGGGTGGGAGGG + Intergenic
989984981 5:50686911-50686933 GCTTCTGGGCCTGTGATGGGAGG + Intronic
991039136 5:62158530-62158552 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
991587319 5:68214942-68214964 GAGTCGGGGGCGGGGTTGGCGGG - Intergenic
992464649 5:76991738-76991760 GTGGCTGGGGCTGGGATGGCAGG + Intergenic
992680987 5:79152904-79152926 GCTACTGGGGAGGTGAAGGCAGG + Intronic
992950268 5:81851386-81851408 GCATTGGGGGCGGGGATGGCGGG - Intergenic
993972830 5:94441248-94441270 AATTCTGGGGCGGGGATTGGGGG + Intronic
994546699 5:101176496-101176518 GCCTCTGGGGCTGTGATGGAAGG - Intergenic
994583983 5:101682416-101682438 GGTTGGGGGGCGGGGGTGGCTGG + Intergenic
994925591 5:106114124-106114146 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
996196292 5:120611412-120611434 GCCTCTGGGCCTGTGATGGCAGG - Intronic
997103723 5:130995326-130995348 GCGCCTGGAGCGGGGATGACGGG - Intergenic
997459634 5:134043104-134043126 GATCCTGGGGCAGGGGTGGCAGG + Intergenic
998416960 5:141953023-141953045 GCTTCTGGGCCTGGGCTGGGAGG - Intronic
999266567 5:150270587-150270609 GCCTCGGGGGCGGGGAGGGGGGG - Intronic
999904827 5:156129044-156129066 GCTTCTGGTGAGGTGATGCCTGG + Intronic
1001028469 5:168244341-168244363 GCTTCTGTGGAGGACATGGCTGG - Intronic
1001106232 5:168856964-168856986 GCTCCTGGGGAAGGGATGGTGGG + Intronic
1001953699 5:175833692-175833714 GGATCTGGGGTGGGGATGGGAGG + Intronic
1002188617 5:177467668-177467690 CGTGCTGGGGTGGGGATGGCGGG - Intronic
1002575429 5:180171281-180171303 GTTTCTGGGGAAGGGAGGGCAGG + Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002788876 6:424298-424320 GCTTCCTCGGCGGGGAGGGCGGG - Intergenic
1003081334 6:3024028-3024050 GCATCCGGGGCGGGGCTGGCAGG + Intergenic
1003086582 6:3065315-3065337 GCGGCTGTGGCGGGGGTGGCTGG + Intronic
1003566870 6:7229722-7229744 GCTTCAGGGGCGGTGGCGGCAGG - Exonic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004756755 6:18618442-18618464 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1005159895 6:22847147-22847169 GCTACTCGGGAGGCGATGGCGGG + Intergenic
1005873200 6:29992795-29992817 GCTTTTTGGCAGGGGATGGCAGG + Intergenic
1005905041 6:30255052-30255074 GCTTCTGGGTCTGTGATGGGAGG + Intergenic
1007214642 6:40227829-40227851 GCTTCTGGGACTGTGATGGGAGG + Intergenic
1007361496 6:41360039-41360061 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1007729012 6:43934580-43934602 GATCCTGGAGCTGGGATGGCAGG - Intergenic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1010176506 6:73033724-73033746 GCTTCGGGGGTGGGTATGGGGGG - Intronic
1010464518 6:76151279-76151301 TCTTCTGAGGCAGGGACGGCTGG + Intergenic
1010884318 6:81217923-81217945 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1011195377 6:84774506-84774528 GATTCGGGGGCGGGGTAGGCCGG + Intergenic
1011343825 6:86346981-86347003 GTTTCTGGGCCTGTGATGGCAGG + Intergenic
1012967094 6:105686934-105686956 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1012998307 6:105994778-105994800 GATTCCGCGGCGGGGATGGCTGG + Intergenic
1013743605 6:113318773-113318795 GCTTCTGGGGCTGGGGAGGAAGG - Intergenic
1014715770 6:124862674-124862696 GCCTCTGGGTCTGTGATGGCAGG + Intergenic
1015569286 6:134604691-134604713 GCTGCTGGAGCGATGATGGCGGG - Intergenic
1016386608 6:143536577-143536599 GCTTCTGGAGCTGGGATGCAAGG - Intergenic
1016624042 6:146145353-146145375 GCTTCTGGGGCTGTGATGGGGGG - Intronic
1017469252 6:154723437-154723459 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1018248498 6:161844766-161844788 GCTTCCGGGGTGGGGGTGGAGGG - Intronic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1018510495 6:164519755-164519777 GCTTCTGTGTCTGTGATGGCAGG - Intergenic
1019189977 6:170246210-170246232 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019189990 6:170246244-170246266 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190003 6:170246278-170246300 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190016 6:170246312-170246334 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190028 6:170246346-170246368 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190041 6:170246380-170246402 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190054 6:170246414-170246436 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190068 6:170246449-170246471 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190081 6:170246483-170246505 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190094 6:170246517-170246539 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190108 6:170246552-170246574 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190120 6:170246586-170246608 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190133 6:170246621-170246643 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190146 6:170246655-170246677 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190159 6:170246689-170246711 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190173 6:170246724-170246746 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190185 6:170246758-170246780 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190199 6:170246793-170246815 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190224 6:170246862-170246884 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190238 6:170246897-170246919 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190251 6:170246931-170246953 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190264 6:170246965-170246987 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190277 6:170246999-170247021 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190314 6:170247102-170247124 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019314267 7:377280-377302 TCTGCTGGGGAGGGCATGGCAGG + Intergenic
1019415883 7:926348-926370 GGTTCTGGGGCGGGGGGCGCTGG - Intronic
1019519181 7:1452981-1453003 GCATCTGGGGAGGGCCTGGCGGG - Intronic
1020119356 7:5494325-5494347 GCTACTGGGGAGGCGAAGGCAGG + Intronic
1020208909 7:6143048-6143070 GCTTCTCCAGTGGGGATGGCCGG + Intronic
1022174756 7:27862354-27862376 ACCTCTGGGGCGGGGGAGGCGGG - Intronic
1023722943 7:43113656-43113678 GCTGCCGGGGCGGGGAGGGGGGG + Intronic
1024476844 7:49821001-49821023 GCATCCTGGGCGGGGAGGGCTGG - Intronic
1024667218 7:51559167-51559189 GCTTCTGGGCCTGTGATGGAAGG - Intergenic
1024765786 7:52657570-52657592 GCTCCATGGGCAGGGATGGCTGG - Intergenic
1025260180 7:57413358-57413380 GCTTCTGGAGCTGGGCTGGTGGG + Intergenic
1026532514 7:71212094-71212116 GCTTCTGGGCCTGTGATGGGAGG - Intronic
1026850080 7:73718804-73718826 GCTCCTGGGGCGGGGTTTGGGGG - Intronic
1029252614 7:99247767-99247789 TCTGCTGGGGCAGGGGTGGCGGG + Intergenic
1030135458 7:106243085-106243107 GCATGTGAGGTGGGGATGGCAGG + Intergenic
1031926068 7:127639762-127639784 GCTACTGGGGCGGCTAAGGCAGG + Intergenic
1032053113 7:128662241-128662263 GCTTCTGGGCCTGTGATGGGAGG - Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032275110 7:130447428-130447450 GCTTCTGGGGTGGGGGTGGGAGG + Intergenic
1032576312 7:133058999-133059021 GCTTCTGGGTAGGGGTTGGAAGG - Intronic
1033171778 7:139091104-139091126 GGTTCTGGGTGGGGGCTGGCGGG - Intronic
1033607533 7:142938359-142938381 GCTTCTTGGGCAGAGATGGTTGG - Intergenic
1033754227 7:144384722-144384744 GCTGCTGGGGTGGGGGTAGCTGG + Intergenic
1034275240 7:149821116-149821138 GCTTCCGGTACGGGGCTGGCAGG + Intergenic
1034404816 7:150896364-150896386 GCTCCTGGGGCCAGGATGGAGGG - Intergenic
1034739634 7:153462255-153462277 GCCTCTGGGCCTGGGATGGGAGG - Intergenic
1035760468 8:2064865-2064887 GCTCCTGGGCAGGGGATAGCTGG - Intronic
1036097618 8:5741345-5741367 GCGTCTGGGGTAGGGGTGGCTGG + Intergenic
1037348525 8:17924097-17924119 GGTTATGGGGCGGGGGTGGTAGG - Intronic
1038250842 8:25902935-25902957 ACTTCTGGGACAGGCATGGCAGG + Intronic
1038834097 8:31099290-31099312 GCTACTGGGGAGGGTAAGGCAGG + Intronic
1039453916 8:37695940-37695962 GCTGGGGGGGCGGGGAGGGCGGG - Exonic
1041548995 8:59079359-59079381 GCTTCTGGGCCTGTGATGGGAGG - Intronic
1044174266 8:89098205-89098227 GCTACTGGGGAGGCTATGGCAGG + Intergenic
1045062778 8:98423590-98423612 GCTGCTGTGGGGAGGATGGCTGG + Intronic
1045383746 8:101651637-101651659 GCTGCTGAGGCGGGGAGGGTAGG - Intronic
1045940124 8:107728733-107728755 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1046052941 8:109044904-109044926 GCCTCTGGGCCGGTGATGGGTGG + Intergenic
1047214221 8:122863724-122863746 GCTCCTGGGGAGGGATTGGCAGG - Intronic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1048007261 8:130429561-130429583 GCTTCTGTGGTATGGATGGCTGG - Intronic
1049292556 8:141812386-141812408 GCCTCCAGGGCGGGGAGGGCGGG + Intergenic
1049325195 8:142017978-142018000 GCAGCTGGGGTGGGGACGGCCGG - Intergenic
1049663152 8:143829415-143829437 GCTTCCGGGGCGGGGAGGAACGG + Exonic
1050832221 9:10028923-10028945 GCTTCTGGGCCTGTGATGGCAGG - Intronic
1053624926 9:39859734-39859756 GCTGCTGGGGTGGGGGTGGGGGG + Intergenic
1053879944 9:42583494-42583516 GCTGCTGGGGTGGGGGTGGGGGG - Intergenic
1053892719 9:42710817-42710839 GCTGCTGGGGTGGGGGTGGGGGG + Intergenic
1054218971 9:62390964-62390986 GCTGCTGGGGTGGGGGTGGGGGG - Intergenic
1054231746 9:62518205-62518227 GCTGCTGGGGTGGGGGTGGGGGG + Intergenic
1054455538 9:65428395-65428417 GCTTGTGGGGCTGGGAAGTCAGG - Intergenic
1055708730 9:79036203-79036225 ACTGCTGGAGCTGGGATGGCAGG + Intergenic
1055939526 9:81636440-81636462 GCTTCTGGGTGGGGGGTGGGGGG + Intronic
1057346972 9:94259735-94259757 GATGGTGGGGAGGGGATGGCGGG - Intronic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1057888096 9:98846282-98846304 GCCTGGGGGGCGGTGATGGCAGG + Intronic
1059407399 9:114109751-114109773 TCCTCTGGGGTGGGGGTGGCGGG - Intergenic
1061202864 9:129147507-129147529 ACTGCTGGGGTGGGGAAGGCAGG - Exonic
1061450089 9:130663082-130663104 GCTTCGGGAGAGGGGATCGCTGG + Intergenic
1061817952 9:133207563-133207585 GCTGCTGGAGCTGGGAAGGCCGG - Intronic
1061865429 9:133489603-133489625 AGTTCTGGGGTGGGGTTGGCAGG + Intergenic
1061882708 9:133575998-133576020 GCTTCTGGGGAGGGGCTGCTTGG + Intergenic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1062242447 9:135547611-135547633 GCTGCTGGAGCTGGGAAGGCCGG + Intronic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062318284 9:135978610-135978632 GCTGCTGAGGCGGGGATGGAGGG - Intergenic
1062364390 9:136202050-136202072 GCTCCTGTGTCAGGGATGGCGGG + Intronic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062519663 9:136952399-136952421 GCATCGGGGGCGGGAGTGGCAGG - Exonic
1062526069 9:136978562-136978584 GCTCCTGGGGCGGGGACGTGAGG + Intronic
1062526115 9:136978698-136978720 GCTCCTGGGGCGGGGATGTGAGG + Intronic
1062526128 9:136978731-136978753 TCTCCTGGGGCGGGGATGTGAGG + Intronic
1062526137 9:136978764-136978786 GCTCCTGGGGCGGAGATGTGAGG + Intronic
1062526151 9:136978797-136978819 TCTCCTGGGGCGGGGATTGAGGG + Intronic
1062531937 9:137005614-137005636 GCTGCAGGGCCGGGGCTGGCAGG + Intergenic
1062549231 9:137078305-137078327 GCGTCTGGAGCGGGGATGTGGGG - Intronic
1187843127 X:23509436-23509458 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
1189421469 X:40861663-40861685 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1192131936 X:68559620-68559642 GCTTCTGGGCCTGTGATGGGAGG + Intergenic
1193962809 X:87947073-87947095 GCTTCTGGGTCTGTGATGGGAGG - Intergenic
1195525962 X:105889863-105889885 GCCTCTGGGCCTGTGATGGCAGG + Intronic
1196503294 X:116411041-116411063 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1199228631 X:145409403-145409425 GCCTCTGGGGCTGTGATGGGAGG - Intergenic
1199603277 X:149556298-149556320 GCTTCTGGGCCTGGGATGGGAGG - Intergenic
1199647111 X:149923177-149923199 GCTTCTGGGCCTGGGATGGGAGG + Intergenic
1199954044 X:152728032-152728054 GCTTCTGGGCCAGGGATGAGAGG + Intronic
1200063648 X:153494857-153494879 GCTGGTGGGGCGGAGAGGGCGGG - Intronic
1200117765 X:153776696-153776718 GGGGCTGGGGCGGGGATGGGGGG + Intronic
1200179408 X:154141189-154141211 CCTTCTGAGGGTGGGATGGCTGG - Intergenic
1200248067 X:154536351-154536373 TCTTCTGGGTCAGGGATGGAGGG - Intronic
1200268855 X:154662498-154662520 GCTTCTGGGTCTGTGATGGGGGG - Intergenic
1200296432 X:154924972-154924994 GCCTCTGGGCCGGTGATGGGAGG + Intronic
1201063637 Y:10069542-10069564 GCTGCTGAGGCGAGGGTGGCGGG + Intergenic
1201904632 Y:19076754-19076776 GGCTCCGGGGCGGGGCTGGCGGG - Intergenic