ID: 1184837127

View in Genome Browser
Species Human (GRCh38)
Location 22:47030579-47030601
Sequence TGCCTTGCCCTGCCACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184837125_1184837127 2 Left 1184837125 22:47030554-47030576 CCTGGTGACTTTACAACAATAAC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1184837122_1184837127 29 Left 1184837122 22:47030527-47030549 CCAGCTTGCCAATATGACACATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1184837123_1184837127 21 Left 1184837123 22:47030535-47030557 CCAATATGACACATCTCTTCCTG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184837127 Original CRISPR TGCCTTGCCCTGCCACATAA GGG Intronic
903180493 1:21602729-21602751 TGCCTTGCTTTGCCACCGAATGG + Intronic
904711188 1:32431786-32431808 TGCCTTGGCCTCCCAGGTAATGG + Intergenic
907406282 1:54255417-54255439 TGCTTTGCCGTGGCACATAGGGG - Intronic
913162350 1:116155674-116155696 GTCCCTGCCCTGCCACATAATGG + Intergenic
914321127 1:146561381-146561403 TGCCTTGGCCTCCCAAAGAATGG - Intergenic
915386630 1:155500118-155500140 TGCTTTGCCCTTCCATTTAAGGG + Intronic
920909130 1:210197850-210197872 TGCCATTCCCTGCCACAACAAGG - Intergenic
922151717 1:223011340-223011362 TGCCTTGCCCTGCCCTGGAAAGG + Intergenic
1066230393 10:33426360-33426382 TACCTTTCCTTGCCACTTAAAGG - Intergenic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1079239160 11:18710291-18710313 TGCCAGGTCCTGACACATAATGG - Intronic
1079339281 11:19598694-19598716 TCCCTAGCTCTGCCACATATGGG - Intronic
1080563336 11:33484533-33484555 TGGCTTCTCCAGCCACATAATGG + Intergenic
1080783268 11:35450517-35450539 TGCCTTTTCCTCCCACATCATGG - Intronic
1081302431 11:41468583-41468605 TGCCTCTCCATACCACATAATGG - Intergenic
1087183480 11:95161490-95161512 ATCCTTGCCCTGCCAAATACTGG + Intergenic
1088768712 11:113011750-113011772 TGCTTTGCTCTGCCAAACAAGGG + Intronic
1088806528 11:113358243-113358265 TTCCTTGCCCTGCCAGAGCACGG - Intronic
1089123906 11:116162665-116162687 TCCCCTGCCCTTCCAAATAAAGG - Intergenic
1089976051 11:122732300-122732322 TGCCATACCCTGACACACAATGG + Intronic
1092210272 12:6641364-6641386 TGCCTGCTCCTCCCACATAACGG + Intronic
1092507468 12:9118555-9118577 TGCATTTCTCTGTCACATAAAGG - Intergenic
1094305080 12:29009401-29009423 TGCCTTACCCTTCCAGAAAAGGG - Intergenic
1094722264 12:33076799-33076821 AGCCCTGCCCTCCCACCTAATGG - Intergenic
1095710408 12:45282088-45282110 TGGCTTGACCAGCCAAATAAGGG + Intronic
1095888711 12:47215638-47215660 TATCTTGCTCTGCCACATACTGG + Intronic
1097638065 12:62145986-62146008 TTCCTTGCCATGCCAAATGATGG + Intronic
1101615035 12:106328143-106328165 TGCCTTCACCTGTCACATGAGGG + Intronic
1102045004 12:109824251-109824273 CACCGTGCCCAGCCACATAAAGG + Intronic
1106777012 13:33017791-33017813 TTCCCTGCCCTGCCGCAGAAGGG - Intronic
1108736696 13:53291378-53291400 TGCCATACCATGCCACACAATGG - Intergenic
1109078452 13:57866927-57866949 TGCCTTGGCCTCCCAAATACTGG + Intergenic
1110479937 13:75962180-75962202 TTCCCTGCCCTTCCACATTATGG - Intergenic
1112164632 13:96905235-96905257 TGCCATCACATGCCACATAATGG - Intergenic
1113066032 13:106375037-106375059 TGGCCTGCCCTGCCACAAAGAGG - Intergenic
1113598704 13:111553076-111553098 TGCCTTGCCCTGTAACACAGAGG + Intergenic
1120936474 14:89900543-89900565 TGTCTTGCCCTGTCACATTCAGG + Intronic
1121486646 14:94321492-94321514 TGCCCTGCCCTGCCCCACAGTGG - Intronic
1123462324 15:20484573-20484595 TGCCTTGGCCTGCCAAATGCTGG - Intergenic
1123655735 15:22515821-22515843 TGCCTTGGCCTGCCAAATGCTGG + Intergenic
1124273013 15:28300571-28300593 TGCCTTGGCCTGCCAAATGCTGG - Intronic
1124309645 15:28610998-28611020 TGCCTTGGCCTGCCAAATGCTGG + Intergenic
1127146801 15:56033219-56033241 TGCCTTGGCCTCCCAAATGATGG + Intergenic
1127704691 15:61535324-61535346 TGCCCCTCCCTGCCACAGAAAGG - Intergenic
1129564780 15:76609888-76609910 AGCCATGCTCTTCCACATAAGGG - Intronic
1129888759 15:79057189-79057211 CGCCTTGCCCTGCGACACCATGG - Intronic
1130379321 15:83358221-83358243 TGCCATGCCCAGCCCCATCAGGG + Intergenic
1132372731 15:101309480-101309502 CGCTTTGCCCTGCCACATTCTGG + Intronic
1132405185 15:101537504-101537526 TGCCTTTCCATGCCATTTAATGG + Intergenic
1132882140 16:2167180-2167202 AGCCGTGCCCTGCCCCATCATGG - Intronic
1134667053 16:16026318-16026340 TGCCTCATCCTGCCACATAGCGG - Intronic
1138095553 16:54208577-54208599 TGCCTTTCCCTGCCACCAACTGG + Intergenic
1142753768 17:2003494-2003516 GGCCTTGCTCTGCCACAAGAAGG + Intronic
1142787169 17:2233404-2233426 TGCCTTGCCCTCCCAGGTACTGG - Intronic
1143056528 17:4166640-4166662 TAGCTTGCCCTGCCCCATGAAGG - Exonic
1146578350 17:34013888-34013910 TGCCTGGCCCTGATAGATAAGGG + Intronic
1147484864 17:40802659-40802681 TGCCCTGAACTGCCAAATAAGGG - Intergenic
1152852174 17:82643670-82643692 TGCCTTTTCCTGTCACATCAGGG - Intronic
1155907352 18:31468009-31468031 TGCCTTGCCCAGCCACACCTGGG - Intronic
1164040765 19:21490821-21490843 TGCCTGGCCCTGCCAAAAAGTGG + Intronic
1164630412 19:29758146-29758168 TGCGGTGTCCTCCCACATAAGGG + Intergenic
1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG + Intergenic
926537386 2:14129677-14129699 TTCCTTGCCCTTCCCCATACAGG - Intergenic
926939262 2:18117849-18117871 TGCTTTCCACTGCCACATGATGG + Intronic
929816236 2:45234520-45234542 TGCTTTGCTCTCCCACAGAAAGG - Intergenic
937791271 2:125964921-125964943 TGCATTTCCCTGGCAGATAATGG - Intergenic
941530476 2:166663954-166663976 TGCCTTTTCCTGCCACTAAAAGG + Intergenic
944057086 2:195534081-195534103 CGCCTTGCTCTGCCACGTAGTGG - Intergenic
945757715 2:213869594-213869616 TGCTTAGCCCTTTCACATAAAGG - Intronic
947187556 2:227468722-227468744 TGCCTTGGCCTCCCAAGTAACGG - Intergenic
947935339 2:233999138-233999160 TGCCCTGCCCTGCCCCAGGAGGG - Intronic
948404652 2:237708165-237708187 TGCCCAGCCCTGCCACCTACAGG + Intronic
1174139556 20:48403583-48403605 TGCCTTCCTCTTCCACATAAAGG + Intergenic
1179547619 21:42123215-42123237 TGCCTGGCCCTCCCACATCGAGG - Intronic
1183121635 22:35734567-35734589 TGCCTGGCCCTGTGACAGAAAGG - Intergenic
1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG + Intronic
951637174 3:24792398-24792420 TGCCTTGCCCAATCACATAAGGG + Intergenic
953947306 3:47160840-47160862 TCCCTGGGCCTGCCCCATAATGG + Intronic
957292767 3:78297949-78297971 TTCCTTGGTCTGGCACATAATGG + Intergenic
963914002 3:150841164-150841186 TGCCTTGCCCTGCCAGGTGAGGG - Intergenic
964487946 3:157205550-157205572 ACCCTGGCCATGCCACATAATGG - Intergenic
965514894 3:169610706-169610728 TGCCTTTCTCATCCACATAATGG + Intronic
966879815 3:184343835-184343857 TGCCCTGGCCTGCCAGAGAAAGG - Intronic
967836722 3:193971106-193971128 TTCCTTTCCTTGCCACAGAAAGG + Intergenic
977711542 4:100132289-100132311 GGCTTTGTCCTGCCACAGAAAGG + Intergenic
978420769 4:108530591-108530613 TGCATTGCCGTGCCATTTAAAGG - Intergenic
980007395 4:127558612-127558634 GGTCCTGCCCTGCCACATGAGGG - Intergenic
985526953 5:409387-409409 TGTCCTGCCGTTCCACATAAAGG - Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
990812703 5:59747123-59747145 GGCCTTGCCATGACAGATAACGG + Intronic
991491557 5:67188492-67188514 TGCCTTTCCTTGACACATAGGGG + Intronic
999889765 5:155964839-155964861 TGCCCAGCTCTGCTACATAAAGG + Intronic
1001168815 5:169397009-169397031 TGCCTTGGCCTCACACAGAATGG + Intergenic
1007608640 6:43134325-43134347 TGCCATGCCCGGCCTCATTAGGG + Intronic
1008060838 6:46995130-46995152 TGCCATGCCATGCCATATATGGG - Intergenic
1016918215 6:149264779-149264801 TGGCTTGCCTTGCTGCATAATGG - Intronic
1017903340 6:158737280-158737302 TGCCTGGCCCTGACACTTAGTGG - Intronic
1018091101 6:160347823-160347845 TGCCCTGCCCTGCCCCACATGGG + Intergenic
1019399716 7:845394-845416 TGCCTTGCCCTCTCAGACAAAGG + Intronic
1022070825 7:26912155-26912177 TGCCTTGACCTCCCAAATTACGG + Intronic
1023339681 7:39206352-39206374 TGCCTTTCCCTACCAGAGAAGGG + Intronic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1032626041 7:133592312-133592334 TGCCTTGGCCTCCCACAATATGG + Intronic
1032829753 7:135610813-135610835 TTCCTTGTCCTGCAACACAAGGG + Intronic
1036555237 8:9853906-9853928 TGCCTGGCTCTGCCACTCAATGG + Intergenic
1037922455 8:22817000-22817022 AGCCTTTCCCTCCCACATAATGG + Intronic
1041624816 8:60013657-60013679 AGCCTTGAGCTGCCAGATAAGGG + Intergenic
1044953125 8:97452734-97452756 TGCCATGCCATGCCATGTAAAGG - Intergenic
1046820196 8:118626409-118626431 TGCGCTGTCCTGGCACATAATGG + Intergenic
1047521766 8:125600423-125600445 TCCCTTGCCCTGCCTGATGAAGG - Intergenic
1048092687 8:131258642-131258664 TGCCTTGCCCTTACACATTCAGG + Intergenic
1048299976 8:133244494-133244516 TGCCTTGTCCTGCCTTACAAAGG + Intronic
1050585095 9:7102493-7102515 TGTCTTGCCCAGCATCATAATGG - Intergenic
1060718657 9:125958500-125958522 TCCCTTTCCCTTCCACATATTGG - Intronic
1061970320 9:134041455-134041477 TGCCTTGCTCTGCTCCAGAAAGG - Intronic
1187385931 X:18848344-18848366 AGACTTGGCCTGCCACATTAGGG + Intergenic
1190912423 X:54785709-54785731 TGCTTTGACCTGACAAATAATGG - Intronic
1196646087 X:118118467-118118489 TGCTTTGTCCTGCCATAAAAAGG + Intergenic
1197174484 X:123470830-123470852 TGCCTTTGCCTGCAACAAAATGG + Intronic