ID: 1184838419

View in Genome Browser
Species Human (GRCh38)
Location 22:47037709-47037731
Sequence ACTTCAGGCCGTTCTCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184838415_1184838419 21 Left 1184838415 22:47037665-47037687 CCTGGCATGCTTTTTATCTGAGA 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1184838419 22:47037709-47037731 ACTTCAGGCCGTTCTCTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184838419 Original CRISPR ACTTCAGGCCGTTCTCTTTG TGG Intronic
901602268 1:10431258-10431280 TCTTCAGTCCGTCCTCTTTAAGG - Intronic
903670960 1:25034990-25035012 ACTGGAGGCCGTGCTCTTGGAGG + Intergenic
904928618 1:34068188-34068210 ACTTCAGGCTGTTCACTTGAAGG - Intronic
906286022 1:44588383-44588405 TCTTCAGGCCTTTCCCTTGGAGG + Intronic
907073998 1:51562761-51562783 AGTTGAGGCCGTTCTCTTCCTGG + Intergenic
914329548 1:146653967-146653989 ACTTCAGGTAGTTCTCATAGGGG + Intergenic
919444920 1:197691137-197691159 TCTTCAGGATGTTTTCTTTGAGG - Intronic
920265834 1:204721963-204721985 ACTGCAGTCCCTTTTCTTTGAGG + Intergenic
1063341747 10:5271818-5271840 ACTTTAAGCCGCTCTCTGTGAGG - Intergenic
1071922199 10:90363209-90363231 ACTTCATACTGTTCTCTGTGGGG + Intergenic
1075048458 10:119164811-119164833 GCTTTAGGGGGTTCTCTTTGAGG - Intronic
1075741689 10:124699941-124699963 GCTTCAGGGAGTTCTCTTTCGGG + Intronic
1080372233 11:31664413-31664435 ACTTGAGGACATTCTTTTTGTGG + Intronic
1082716631 11:56621818-56621840 GCTTCAGCCCCTTCTTTTTGTGG - Intergenic
1082797698 11:57389908-57389930 ACTTCTGGCTCTTCTATTTGGGG - Exonic
1084333912 11:68446117-68446139 ACTTCGGCCAGTTCCCTTTGTGG - Intronic
1094208621 12:27866915-27866937 GCTTCAGACGGTTCTCTGTGTGG - Intergenic
1095697913 12:45161559-45161581 ACTTCAGGCCAATATCCTTGGGG - Intergenic
1096197480 12:49657954-49657976 CCTTCAGGCCTTTCTCTCTGAGG - Intronic
1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG + Intergenic
1102941703 12:116948097-116948119 TTTGCAGGCCATTCTCTTTGTGG - Intronic
1104502491 12:129299765-129299787 CCTTCAGGGCGTTCTCATGGTGG + Intronic
1108682793 13:52793841-52793863 ACTTCAGGCCTTTGGCTTTCTGG - Intergenic
1109067485 13:57717086-57717108 GCTTCAGCCAGTTCTCTTCGGGG + Intronic
1110462778 13:75764343-75764365 ACTTCACCACGTTTTCTTTGTGG - Intronic
1112810776 13:103216145-103216167 TCTTCAGGCTGTTGACTTTGCGG + Intergenic
1114791277 14:25661196-25661218 AGGTTAGGCAGTTCTCTTTGAGG + Intergenic
1115753401 14:36512553-36512575 ACTTCAGGCCACCCTCTGTGGGG - Intronic
1116346111 14:43796664-43796686 AGTAAAGGCGGTTCTCTTTGGGG - Intergenic
1117963657 14:61186339-61186361 GGTTCAGGGTGTTCTCTTTGAGG + Intergenic
1119640347 14:76310101-76310123 ACTTCAGGCCGTTCTTCTGTTGG + Intergenic
1122397712 14:101445717-101445739 TTATCATGCCGTTCTCTTTGAGG + Intergenic
1123051796 14:105547613-105547635 ACTTCTGGCCGCTCACCTTGCGG + Intergenic
1126069636 15:44854598-44854620 ACTTCAGGAAGTACTCTCTGCGG + Intergenic
1126088895 15:45034565-45034587 ACTTCAGGAAGTACTCTCTGCGG - Intronic
1132614849 16:835397-835419 CCTTCAGGCCCATCACTTTGTGG - Intergenic
1133921962 16:10161554-10161576 ACATCAGGCTGTGCCCTTTGTGG - Intronic
1138786607 16:59853991-59854013 TCTTCAGGCCGTTTTCATTTTGG + Intergenic
1139914424 16:70419262-70419284 ACTTCAGGCCACAGTCTTTGCGG + Intronic
1140004013 16:71056971-71056993 ACTTCAGGTAGTTCTCATAGGGG - Intronic
1146377180 17:32302719-32302741 GATTCAGGCCGTTACCTTTGAGG + Intronic
1148770682 17:50064259-50064281 CCTCCAGGCCATTCTCTCTGCGG - Intronic
1149507069 17:57203311-57203333 ACTTCAGGCCGGCCTCTGTGAGG - Intergenic
1152529625 17:80909928-80909950 ATTTTAGTCCTTTCTCTTTGGGG + Intronic
1153065070 18:1036183-1036205 ACTTCAGGGCCTTTTGTTTGGGG + Intergenic
1156161164 18:34359912-34359934 TCTTCAGACTGTTCTCTTTCTGG + Intergenic
1156751222 18:40458113-40458135 ACATCATGCCTTTCTCTTAGTGG + Intergenic
1158584097 18:58715079-58715101 ACTTGAGGCAGGTCTCATTGAGG - Intronic
1162639280 19:11995330-11995352 ACTTCAGGCTGTGCTCTGGGAGG - Intergenic
927049399 2:19311998-19312020 ACTTCAGGCACTTATCTCTGGGG + Intergenic
927148016 2:20179684-20179706 ACTGCAGGCTGCTCTCTGTGGGG + Intergenic
928170351 2:28999319-28999341 ACCTCAGGGCCTTGTCTTTGGGG + Exonic
928255987 2:29723051-29723073 CCTTCAGTCTGTTCTCTATGTGG + Intronic
930917055 2:56705350-56705372 ACTTCTTCCAGTTCTCTTTGAGG + Intergenic
932405545 2:71510636-71510658 CCTTCAGGCCCTTCTCTCTTGGG + Intronic
934017301 2:87901135-87901157 ACATCAGGTCCTTCTCTTTGTGG + Intergenic
936380712 2:111983440-111983462 ACTTCTTGCCATTCTCTATGAGG - Intronic
938321960 2:130371921-130371943 ACTTAAGGCCCTTGTCCTTGCGG + Intronic
941799461 2:169641126-169641148 AATTGTGGCCGCTCTCTTTGTGG + Exonic
944021071 2:195105071-195105093 ACTTCAGGCCAATATCCTTGAGG + Intergenic
944629117 2:201605335-201605357 ACTTCTGGTCCTTCTCTTTCAGG - Intronic
946712976 2:222525398-222525420 ATTTCAGGCCCCTCTCTGTGAGG - Intronic
948562922 2:238865975-238865997 TCTTCAGGCCCTTCTTTGTGTGG + Intronic
1179801004 21:43811455-43811477 ACTTCTGACCCTTCTCTTTGGGG + Intergenic
1179821112 21:43937461-43937483 ACTGCAGGCCTGTCTCCTTGAGG + Intronic
1182696337 22:32201661-32201683 ACATCAGGACTTTCTCTGTGAGG + Intronic
1182715801 22:32355417-32355439 ACATCAGGACTTTCTCTGTGAGG - Intronic
1183009493 22:34933060-34933082 ACTACAGGCTGTTCCCATTGTGG + Intergenic
1184838419 22:47037709-47037731 ACTTCAGGCCGTTCTCTTTGTGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
953794684 3:45975510-45975532 ACTTCAAGCCTTACTCTCTGCGG - Intronic
953926193 3:46983716-46983738 ACTACAGGCCCTTCTCCTTCAGG - Intronic
961187525 3:124928767-124928789 ACTTCAGACCATTCTCAGTGAGG + Intronic
967473726 3:189891781-189891803 TCTTCATGCTGCTCTCTTTGGGG + Intronic
970842247 4:20488201-20488223 ATTTCAGTCCCTGCTCTTTGAGG + Intronic
972003776 4:34072590-34072612 ACTTCAGGCTGTTTTTTTGGAGG - Intergenic
972319595 4:37961193-37961215 ACTACAGCCCGTACTCTTTGGGG + Intronic
973314909 4:48749674-48749696 TGTTCTGGCTGTTCTCTTTGTGG + Intronic
975847709 4:78542225-78542247 ATTTCAGGGATTTCTCTTTGAGG + Intronic
977576791 4:98683497-98683519 GCTTCAGGCCGCTCTCATGGTGG - Intergenic
978060703 4:104334105-104334127 ACTTCAGGCCAATATCCTTGAGG + Intergenic
980281368 4:130725384-130725406 ACTTCAGGCTGCTCTCTCTGTGG - Intergenic
984793153 4:183632736-183632758 ACTTCTGGCCATCCTCTGTGAGG - Intergenic
986904036 5:12471533-12471555 ACTTCAGGCCAATATCTTTGAGG + Intergenic
988361986 5:30248222-30248244 TTTTCAGGCTGTTCACTTTGTGG - Intergenic
993494315 5:88590313-88590335 ACTTCAGGCCAATATCCTTGAGG + Intergenic
1000809475 5:165843495-165843517 CCCTCAGGCAGTTCACTTTGTGG - Intergenic
1003648774 6:7938746-7938768 ACTTCAGGTTGTTCTCCTTCTGG - Intronic
1007287767 6:40760253-40760275 ACATAGGGCTGTTCTCTTTGAGG - Intergenic
1010025937 6:71216929-71216951 ACTTTAGCCCATTCTCTTTTTGG + Intergenic
1010783145 6:79968845-79968867 ACTTCAGGCCAATATCCTTGAGG + Intergenic
1014604694 6:123458433-123458455 ACTTCAGTCTTTTCTCTTTAAGG - Intronic
1015344877 6:132144681-132144703 ACTCCAGGCTGATCTTTTTGGGG - Intergenic
1016944926 6:149522205-149522227 TCTTCAGAGCTTTCTCTTTGGGG - Intronic
1017919322 6:158857578-158857600 CCTCCAGGGAGTTCTCTTTGAGG - Intergenic
1019376324 7:694443-694465 ACTCCAGGCTAGTCTCTTTGGGG - Intronic
1022800756 7:33775095-33775117 CCTTAAGGCCATTCTCGTTGTGG - Intergenic
1022945434 7:35279407-35279429 ACTTCAGCCTGTTCTCTCTAAGG - Intergenic
1024023577 7:45392004-45392026 GCTTCTGGCCGCTCCCTTTGCGG + Intergenic
1031906068 7:127460878-127460900 ACTACAGGCCAATATCTTTGAGG + Intergenic
1034366589 7:150554838-150554860 ACTTCAGGCCAGTATCTCTGAGG + Intergenic
1034384979 7:150733414-150733436 ACCTCAGGGCTTTCTCCTTGGGG + Intronic
1039402588 8:37282933-37282955 ACTTCAGGCCATTATCTCTGAGG + Intergenic
1047758115 8:127934209-127934231 ACTCCATGCAGTTCTTTTTGGGG + Intergenic
1048201665 8:132379679-132379701 AATTAAGGACGTTCTATTTGAGG - Intronic
1056740678 9:89251751-89251773 ATTTCAGGCAGTTATGTTTGGGG - Intergenic
1056998601 9:91487266-91487288 ACTTCAGGCCCTTCTCTCAGGGG + Intergenic
1190118197 X:47639308-47639330 ACTTCTGGCCGCTCACCTTGCGG + Exonic
1193894460 X:87095512-87095534 AGTTCAGGCCAATATCTTTGAGG - Intergenic
1195610388 X:106860126-106860148 ACTTCAGGCCAATATCCTTGAGG - Intronic
1197069848 X:122283470-122283492 ACTACAGGCCAATATCTTTGAGG + Intergenic
1198575971 X:138010661-138010683 TCTTCAGGCTCTTCTCTGTGAGG - Intergenic
1199127182 X:144137410-144137432 ACATCAGGTCCTTCTCTTTGTGG - Intergenic
1200927028 Y:8663887-8663909 ACTTCACGGCATTCTCATTGTGG + Intergenic
1201907171 Y:19097379-19097401 ACTTCAGGCATTCCTGTTTGGGG - Intergenic