ID: 1184839249

View in Genome Browser
Species Human (GRCh38)
Location 22:47043020-47043042
Sequence ATCAGCGCCTGCTCCGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184839241_1184839249 5 Left 1184839241 22:47042992-47043014 CCCCGAATCACTCAGCCCACGTG No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data
1184839242_1184839249 4 Left 1184839242 22:47042993-47043015 CCCGAATCACTCAGCCCACGTGC No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data
1184839243_1184839249 3 Left 1184839243 22:47042994-47043016 CCGAATCACTCAGCCCACGTGCA No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data
1184839240_1184839249 12 Left 1184839240 22:47042985-47043007 CCTTGGGCCCCGAATCACTCAGC No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data
1184839244_1184839249 -10 Left 1184839244 22:47043007-47043029 CCCACGTGCAGTTATCAGCGCCT No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data
1184839239_1184839249 20 Left 1184839239 22:47042977-47042999 CCTGGGCACCTTGGGCCCCGAAT No data
Right 1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184839249 Original CRISPR ATCAGCGCCTGCTCCGGGTT GGG Intronic