ID: 1184839526

View in Genome Browser
Species Human (GRCh38)
Location 22:47044312-47044334
Sequence AAGGACTCCTGGGGAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184839526_1184839537 16 Left 1184839526 22:47044312-47044334 CCTGCCTTTCCCCAGGAGTCCTT 0: 1
1: 0
2: 2
3: 50
4: 480
Right 1184839537 22:47044351-47044373 GCTCCTTTGAAAGGCTGCCTCGG 0: 1
1: 1
2: 0
3: 15
4: 180
1184839526_1184839534 7 Left 1184839526 22:47044312-47044334 CCTGCCTTTCCCCAGGAGTCCTT 0: 1
1: 0
2: 2
3: 50
4: 480
Right 1184839534 22:47044342-47044364 GCTGTCCCAGCTCCTTTGAAAGG No data
1184839526_1184839538 17 Left 1184839526 22:47044312-47044334 CCTGCCTTTCCCCAGGAGTCCTT 0: 1
1: 0
2: 2
3: 50
4: 480
Right 1184839538 22:47044352-47044374 CTCCTTTGAAAGGCTGCCTCGGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184839526 Original CRISPR AAGGACTCCTGGGGAAAGGC AGG (reversed) Intronic
900422754 1:2562663-2562685 TGGGCCTCCTGGGGACAGGCTGG + Intronic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
900633785 1:3652120-3652142 AGGGAGTCCGGGGGAAACGCAGG + Intronic
900908953 1:5580544-5580566 ATGGATCCCTTGGGAAAGGCTGG + Intergenic
900950458 1:5855614-5855636 AAGGCCTGCTGAGGCAAGGCCGG + Intergenic
901004811 1:6166540-6166562 AGGGACTGCTGGGGAAAGGATGG - Intronic
901441867 1:9282839-9282861 AAGGTCTCCTGGGGCAGGGTGGG + Intergenic
901951012 1:12746577-12746599 AGGGACTGATGGGGAGAGGCAGG + Intronic
902037523 1:13468373-13468395 AAGGACTTCTGGGGATGGGGAGG - Intergenic
902513472 1:16978307-16978329 GAGGACAGCTGGGGAAAGACCGG + Exonic
902532196 1:17097722-17097744 AAGGACCCCAGGGGAAAGAAGGG + Intronic
902643038 1:17778974-17778996 AAACAGTCCTGGGGAGAGGCAGG - Intronic
902806469 1:18864170-18864192 AAGAGCTCCTTGGGGAAGGCAGG + Intronic
902906782 1:19564097-19564119 AAGTAATAATGGGGAAAGGCAGG - Intergenic
903294616 1:22335814-22335836 GAGCACACCTGGGGCAAGGCTGG - Intergenic
903781183 1:25820849-25820871 GAGGACTCCGAGGGACAGGCAGG + Intronic
904906312 1:33899820-33899842 AAGGGCACATGGGGAAAGTCGGG - Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905212596 1:36385169-36385191 AAGCTCTCCTTGGAAAAGGCCGG + Intronic
905564056 1:38949296-38949318 AGGGACTCAAGGGGAAAGGCTGG + Intergenic
905910528 1:41650207-41650229 AGGGACTGCTGGGGAATGGGAGG + Intronic
906168392 1:43704910-43704932 AAGGGCTCCTGGGGGTTGGCTGG + Exonic
906794333 1:48684990-48685012 AATGACTCCTGAGGCAGGGCAGG + Intronic
907302296 1:53495996-53496018 ATGGAGGCCTGGGGAAGGGCAGG - Intergenic
907374247 1:54022454-54022476 TAGGACTCCTGGGCCAGGGCTGG + Intergenic
907483569 1:54761173-54761195 AAGGCTTCCTGGGGAGAGGATGG - Intronic
907853020 1:58274567-58274589 AAGCACGCCTGGGCAATGGCGGG + Intronic
908073629 1:60490575-60490597 AAGCAATCCTGGGCAATGGCGGG - Intergenic
908248697 1:62248106-62248128 AAGGCTTCCTGGGGAAAGTCAGG - Intronic
909255542 1:73415903-73415925 AAGAACTTCTGGAAAAAGGCAGG + Intergenic
910712594 1:90196966-90196988 CAGGACTCCAGGAGAAAGACGGG - Intergenic
912572742 1:110636569-110636591 AAGAACTCCTGGAAAATGGCTGG + Intergenic
913039702 1:115010515-115010537 AAGGTCTCCTTGGGGAAGGATGG - Intergenic
913446311 1:118954368-118954390 GAGATCTCCTGGGGATAGGCTGG - Intronic
915143295 1:153779811-153779833 AAAGACTCCTGGGGACAGGAGGG - Exonic
916312999 1:163417521-163417543 AAGAAGTCATGGGGGAAGGCTGG + Intergenic
916661245 1:166924006-166924028 AAGGACTCTTGGGGATAGCAAGG - Intronic
918118303 1:181515914-181515936 AATGAGTGCTGGGGGAAGGCTGG + Intronic
918284608 1:183039878-183039900 TAGAACCCCTGGGGAAAGGTAGG + Intronic
919499182 1:198314994-198315016 AAGCACGCCTGGGCAATGGCGGG + Intronic
919982733 1:202652415-202652437 CAGGCCTCCTGCAGAAAGGCAGG - Intronic
920330960 1:205207835-205207857 GAGCACTTCTGAGGAAAGGCAGG - Intronic
920826673 1:209429344-209429366 AATGACTCCTGAGGAAAGGTGGG - Intergenic
921220109 1:212967633-212967655 AAGGACAGATTGGGAAAGGCTGG + Intronic
922722323 1:227905327-227905349 GAGGACTCCTGGGAATAGCCTGG + Intergenic
922968826 1:229716996-229717018 AATAACCCCTGGAGAAAGGCAGG - Intergenic
923279678 1:232431081-232431103 AAGGACTCTTTTGGAAAGTCAGG - Intronic
923827566 1:237516838-237516860 ACTGACTGCTGTGGAAAGGCAGG - Intronic
1063478157 10:6346768-6346790 AGGGACTGCTGGGAAAAGCCAGG + Intergenic
1064728234 10:18302690-18302712 GAGGACTCAGGGGGAAAGGGTGG + Intronic
1066034720 10:31469643-31469665 AAGGAAGCCTGGGCAATGGCGGG - Intronic
1066982917 10:42435825-42435847 AAGGAAGCCTGGGCAATGGCGGG - Intergenic
1067199434 10:44154533-44154555 AGGGCCTGCTGGGGAAAGACTGG - Intergenic
1068363143 10:56007081-56007103 GGGGACTCCGGGGGAAAGGATGG - Intergenic
1069573327 10:69507384-69507406 AAGGGCATCTGGGGAAGGGCAGG + Exonic
1069587857 10:69620592-69620614 ATGGTCTGCAGGGGAAAGGCAGG - Intergenic
1069774758 10:70919848-70919870 CAGGTCTCCTGGGAACAGGCAGG - Intergenic
1069809049 10:71145009-71145031 CAGGACTCCTGGGGAAGAGTTGG - Intergenic
1070813122 10:79308175-79308197 GAGGACTCCAGGGGACAGGAGGG - Intronic
1071809707 10:89166217-89166239 ACTTACTCCTGGGAAAAGGCCGG + Intergenic
1072168598 10:92838377-92838399 AAGGGCTCATTGGGAAAGTCAGG - Intronic
1072691427 10:97574598-97574620 AAGGACTTGTTGGAAAAGGCTGG + Intronic
1072979416 10:100087292-100087314 TGGGGCTCCTGGGGAGAGGCTGG + Intergenic
1073242681 10:102068458-102068480 GAGGAGTCCTGGGGAAAGGAAGG - Intergenic
1073265572 10:102226419-102226441 AGGAACTCCTGGGCAAAGGGAGG - Exonic
1073466057 10:103695079-103695101 GAGGGCTACTGGGGAAGGGCAGG + Intronic
1073684366 10:105736155-105736177 AAGCAAGCCTGGGGAATGGCAGG - Intergenic
1074054030 10:109906037-109906059 CAGGACCTCTGGGGAGAGGCAGG + Intronic
1075445929 10:122512855-122512877 GGGGACTCAAGGGGAAAGGCTGG - Intronic
1075761843 10:124863443-124863465 AAAGAAGCCTGGGGAAAGGTAGG + Intergenic
1075940540 10:126387639-126387661 AAGGAAACCTGGTGAAGGGCTGG + Intronic
1076017620 10:127040698-127040720 AAGGACATCAGAGGAAAGGCTGG - Intronic
1076126144 10:127975568-127975590 AGGGTCACCTGGTGAAAGGCAGG + Intronic
1076227560 10:128792613-128792635 AAGGGCTGTTGGGGAGAGGCAGG + Intergenic
1076689401 10:132213746-132213768 AAGGGCTCCAGGGGAAAAGCAGG + Intronic
1077204514 11:1336251-1336273 ATGGACGCCTGGGGTGAGGCTGG + Intergenic
1077826861 11:5820355-5820377 AAAGAATCCTGGGGTCAGGCTGG - Exonic
1080585404 11:33676998-33677020 AAGGACTCATGAGGAAAGGGTGG - Intergenic
1081009306 11:37788542-37788564 AGGGACACAGGGGGAAAGGCTGG - Intergenic
1081193822 11:40136753-40136775 GAGGAATCCTGGGGAAAAGTGGG + Intronic
1082956015 11:58870637-58870659 CAAGCCTCCTGGGTAAAGGCAGG + Intronic
1083301530 11:61742095-61742117 AAGGACACATGTGGACAGGCAGG + Intronic
1083481217 11:62948964-62948986 AAGGGCCCCTGGGGAAACCCAGG - Intronic
1084522322 11:69671486-69671508 AATGACTCCAGGTAAAAGGCAGG + Intronic
1084579554 11:70014615-70014637 AAGGTCTCTTGGGGAACGTCTGG + Intergenic
1084774291 11:71365132-71365154 CAGGGCTCCTGGGGAAGGACCGG - Intergenic
1085394957 11:76202540-76202562 ACGGAAGCCTGGGGAGAGGCTGG - Intronic
1086077758 11:82872656-82872678 GGGGACTCCTGGGGAGAGCCTGG - Intronic
1088420960 11:109646280-109646302 AAGGAATCAGGGAGAAAGGCAGG + Intergenic
1089837948 11:121388107-121388129 GAGGACTCAGGGGGAAAGGGTGG + Intergenic
1091451644 12:575881-575903 CAGGACTGCTGAGAAAAGGCAGG - Intronic
1091601595 12:1921267-1921289 AAGGACTCCTTGGAAAGGGGTGG - Intergenic
1092290614 12:7157749-7157771 GAGGACTCCTGAGGAGGGGCAGG + Intronic
1092375962 12:7955659-7955681 AAGGACTTCAGAGGACAGGCAGG + Intergenic
1092629719 12:10364399-10364421 GAGGAATCCTGGGGCAAGGAAGG + Intergenic
1092752340 12:11730481-11730503 AAGGAAGCCTGTGCAAAGGCAGG + Intronic
1092936071 12:13365893-13365915 AAGGGCCCCTCAGGAAAGGCTGG + Intergenic
1093001542 12:14002157-14002179 GAGGACTCAGGGGGAAAGGGTGG - Intergenic
1093605941 12:21088147-21088169 AAGCAATCCTGGGCAATGGCGGG + Intronic
1094102334 12:26777839-26777861 AAGGTCTCCTTGGGGAAGGATGG - Intronic
1095494546 12:42770941-42770963 AAGGACTCCTAGGAAAAGACTGG - Intergenic
1095691913 12:45099330-45099352 AAGGACTCTTTGGAAAAGGTAGG - Intergenic
1095867835 12:46992253-46992275 AAGCACGCCTGGGCAATGGCAGG - Intergenic
1096080010 12:48826959-48826981 AATGACTCCTGGGGAGGGGGAGG - Exonic
1096195735 12:49647797-49647819 TAGGCCTCCTGGGGAAGGGGTGG + Exonic
1097306877 12:58079068-58079090 GAGGAGGCCTGGGGAAAGGGTGG + Intergenic
1097843558 12:64344177-64344199 CAGGTCTCCTGGGGGAAGGATGG + Intronic
1098281055 12:68863283-68863305 GAGGAGTCCAGGGGAAAGACAGG + Intronic
1100733363 12:97498719-97498741 AAGGACTTCTCAAGAAAGGCTGG - Intergenic
1100970950 12:100069695-100069717 GAGGACTCAGGGGGAAAGGGTGG + Intronic
1101263933 12:103064695-103064717 AAGGTCTCCTTGGGGAAGGATGG - Intergenic
1101452198 12:104789868-104789890 GGGGACTCCGGGGGAAAGGGTGG - Intergenic
1101800441 12:108017069-108017091 TAGGGCTCCTGGGTCAAGGCAGG + Intergenic
1101805782 12:108062375-108062397 AGGTACACCTGGGGAAGGGCTGG + Intergenic
1102452176 12:113050088-113050110 AAGAACCCCTTGGGAAACGCAGG + Intergenic
1103212694 12:119178554-119178576 CAGGTCCCCAGGGGAAAGGCAGG + Intergenic
1103247882 12:119473608-119473630 GGGGACTCCTGGGGGAAGGGTGG - Intronic
1103520450 12:121534376-121534398 AAGTACTCCTGGGGCAGGGCTGG + Intronic
1103694211 12:122800967-122800989 AAGGATTCCTGGAGAAGGTCGGG + Intronic
1104714155 12:131005560-131005582 ATGCACTCGTGGGGCAAGGCTGG + Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105326328 13:19373662-19373684 GGGGACTCCTGTGCAAAGGCAGG + Intergenic
1105705259 13:22964388-22964410 AAGGTTCCCTGGGGAAGGGCTGG - Intergenic
1105858174 13:24389404-24389426 AAGGTTCCCTGGGGAAGGGCTGG - Intergenic
1105867171 13:24471323-24471345 GGGGACTCCTGCGCAAAGGCGGG - Intronic
1106414801 13:29537507-29537529 AAGGACACCTGGGGAAAATGAGG + Intronic
1108359089 13:49652760-49652782 AGGGGGTCCTGGGGAAAGGGCGG + Intergenic
1109419202 13:62088374-62088396 AAGCACTCATGGGGAATGGTAGG + Intergenic
1110092565 13:71471285-71471307 AAGGAACACTGGAGAAAGGCAGG + Intronic
1110530367 13:76590448-76590470 AAGGACTACTGGACACAGGCAGG - Intergenic
1111993785 13:95142418-95142440 AAGGACTTGAGGGGAAAGGTTGG + Intronic
1112492176 13:99877004-99877026 AAGGCTTCCTGGGGCAGGGCTGG - Intronic
1112583763 13:100698537-100698559 AAGCACGCCTGGGCAATGGCGGG - Intergenic
1113973789 13:114211332-114211354 AAAGACCCCTGTGGACAGGCTGG - Intergenic
1113994152 14:16053139-16053161 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1115708121 14:36019117-36019139 AAGGAATCCTTAGGAAAGGAGGG - Intergenic
1116010916 14:39351300-39351322 AACAACACCTGGGGAAATGCTGG - Intronic
1116390313 14:44383604-44383626 AAAGACTACTGGTGAAATGCAGG - Intergenic
1116671218 14:47845770-47845792 AAGGATCCCTGGGGAAAACCTGG - Intergenic
1117199148 14:53370757-53370779 AATGAGTCCTGGGGAATGGTGGG + Intergenic
1117653289 14:57928352-57928374 GAGGAGGCCTGTGGAAAGGCAGG + Intronic
1118315104 14:64721394-64721416 ATGGACTCCAGGAGAAAGCCTGG - Intronic
1118467195 14:66041781-66041803 AAAGCCTCATGGGGTAAGGCGGG + Intergenic
1121020275 14:90575634-90575656 CTGGGCTCCTGGGGACAGGCTGG + Intronic
1121108389 14:91295654-91295676 ATGGGCTCCTGGAGAGAGGCGGG + Intronic
1121129857 14:91436429-91436451 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1121960285 14:98253381-98253403 CAGGCCACATGGGGAAAGGCAGG + Intergenic
1122307903 14:100777093-100777115 AAGGGCTCCACGGGGAAGGCTGG + Intergenic
1122577348 14:102750741-102750763 GGGGTCTCCTGGGGAGAGGCTGG + Intergenic
1122857957 14:104568957-104568979 CAGGAGCCCTGGGGAAGGGCTGG - Intronic
1122918528 14:104869919-104869941 GAGGACGCCTGGGGAGAAGCTGG - Intronic
1123809818 15:23912505-23912527 ACTGACTCCTGAGGAAAGGCAGG - Intergenic
1123872948 15:24594801-24594823 AAGGACTTCTGGGGACAGGCTGG - Intergenic
1125226792 15:37405011-37405033 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1125343879 15:38699492-38699514 CCAGACCCCTGGGGAAAGGCAGG - Exonic
1125608763 15:40957134-40957156 AAGAACATCTGGGGACAGGCAGG - Intergenic
1127442200 15:59021072-59021094 AAGGACTTTGGGGGAAAGGGTGG - Intronic
1127547818 15:60006067-60006089 AAGTTCTCTTGGGGCAAGGCGGG - Exonic
1128331945 15:66761745-66761767 AAGGATTCCTTGGGAATGTCTGG - Intronic
1128516600 15:68345815-68345837 TTGGACTCCTGGGGACAGGATGG + Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1130342432 15:83011149-83011171 ACAGCCTCCTGGGGAAACGCAGG + Intronic
1130945338 15:88546616-88546638 CAGGAGTCCTGGGGCATGGCGGG - Exonic
1131014785 15:89049450-89049472 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1131177631 15:90219969-90219991 ATAGACCCCTGAGGAAAGGCAGG + Intronic
1131374202 15:91910115-91910137 GACCACCCCTGGGGAAAGGCAGG - Intronic
1131488924 15:92845037-92845059 AGGTACTACTGGAGAAAGGCTGG - Intergenic
1131516823 15:93084273-93084295 AACGTCTCCTGGGCAAATGCTGG - Intronic
1131785704 15:95909064-95909086 AAGCATTCCTGGGGAGAAGCTGG - Intergenic
1132102737 15:99036621-99036643 CAGGAATCCTGGGGAAAGAGAGG + Intergenic
1132204602 15:99977806-99977828 AAGGGCTCCTGGGAGAAAGCAGG - Intronic
1132416896 15:101626892-101626914 AAGGAAGCCTGGGCAATGGCGGG - Intronic
1132459225 16:42082-42104 AAGGAGTCCTGGGGCAAAGGAGG + Intergenic
1132482369 16:172946-172968 AAGGCCGCCTGGGGTAAGGTCGG + Exonic
1132483217 16:176750-176772 AAGGCCGCCTGGGGTAAGGTCGG + Exonic
1133535483 16:6698493-6698515 AAGCGCTCATGGGGAAAGACAGG - Intronic
1133703580 16:8332276-8332298 AAGGGCTCCAGGCGAAATGCAGG + Intergenic
1133877698 16:9750528-9750550 AAGGAAGCCAGGGGAGAGGCAGG + Intergenic
1134285894 16:12862052-12862074 CAGGACTCTTGGGGTCAGGCTGG - Intergenic
1135532465 16:23266324-23266346 AAGGATTCCTGGAGGGAGGCTGG + Intergenic
1136453069 16:30365262-30365284 GTGGACTGCTGGGGAAAGGTTGG - Intronic
1136552576 16:30989480-30989502 CAGGACTCCTGGGGCCTGGCTGG - Exonic
1137041120 16:35614042-35614064 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1137251137 16:46741693-46741715 AAGGGCTTCTGTGGCAAGGCAGG - Intronic
1137294250 16:47074995-47075017 CAGGGCTCCTGCGGAAAGGCAGG + Intergenic
1137439534 16:48486133-48486155 AAGAAATATTGGGGAAAGGCCGG - Intergenic
1138219141 16:55236224-55236246 CAAGACTACTGTGGAAAGGCAGG - Intergenic
1139372117 16:66475441-66475463 AGGGATCCCTGGGGAAAGTCAGG - Intronic
1139589481 16:67925653-67925675 AGTGACTCCTGGGGAGATGCTGG - Intronic
1139613744 16:68076617-68076639 ATGCTCTCCTGGGGAAAGGAAGG - Exonic
1139631695 16:68235435-68235457 AAGGAGCCCAGGGGAATGGCTGG + Intronic
1141520640 16:84576655-84576677 GATGACTGGTGGGGAAAGGCTGG - Intronic
1141771653 16:86093301-86093323 AAGGACACCTGGGGAGATGCAGG - Intergenic
1143136829 17:4716804-4716826 AAGGACTCCTGGGGATGAGAAGG - Intronic
1144124955 17:12194623-12194645 GGGGACTCATGGGGAAAGGGTGG + Intergenic
1144185246 17:12790176-12790198 AGGGAGTCCCGGGGAAAGGCAGG - Intronic
1144625862 17:16844170-16844192 AAGGAGTCCTGGGGTCAGGAGGG + Intergenic
1144626849 17:16848203-16848225 AAGCACTGCTGGGGAGAAGCAGG + Intergenic
1144879589 17:18424509-18424531 AAGCACTGCTGGGGAGAAGCAGG - Intergenic
1144880571 17:18428550-18428572 AAGGAGTCCTGGGGTCAGGAGGG - Intergenic
1145151665 17:20515837-20515859 AAGGAGTCCTGGGGTCAGGAGGG + Intergenic
1145152651 17:20519878-20519900 AAGCACTGCTGGGGAGAAGCAGG + Intergenic
1146163027 17:30570095-30570117 AAGGAGTCCTGGGGTCAGGAGGG + Intergenic
1147580015 17:41622868-41622890 AAGGAATCCTGGGGTCAGGAGGG + Intronic
1148219417 17:45851320-45851342 AAGGCCTGGTGGGGAAAGGCTGG - Intergenic
1148901917 17:50884840-50884862 AAGGTCTCCAGGGGCCAGGCAGG + Intergenic
1151126390 17:71849767-71849789 TATGACTCCTGGGGAAAGGTAGG + Intergenic
1151502146 17:74497470-74497492 AAGGAGTCCTGGGAGCAGGCAGG + Intergenic
1151659939 17:75513832-75513854 CAGGAGTCCAGGGCAAAGGCAGG + Exonic
1151952411 17:77362420-77362442 CAGGACTGCTGGGGCAAGGGAGG + Intronic
1152499128 17:80696588-80696610 ATGGCCTCCCGGGGCAAGGCCGG + Intronic
1152717680 17:81907714-81907736 GAGGTCTCCAGGGGAAAGGAGGG - Intronic
1155004703 18:21718226-21718248 AGGGACTCAGGGGGAAAGGGTGG + Intronic
1156303669 18:35857309-35857331 GAGGACTCCTTGGGGAAGGGTGG - Intergenic
1156507146 18:37604841-37604863 TAAGAGTCCTGGGAAAAGGCAGG + Intergenic
1157259156 18:46163839-46163861 AAGGTATCCTGGGCAAAGTCTGG - Intergenic
1157347405 18:46852296-46852318 AAAGACTCTTTGGGAAAGGCAGG + Intronic
1158339372 18:56448922-56448944 TGGGGCTCGTGGGGAAAGGCTGG - Intergenic
1159405741 18:68000744-68000766 AAGAACCACTGGGAAAAGGCAGG + Intergenic
1160135365 18:76266743-76266765 AAGGACTTCACGGGAAAGCCTGG + Intergenic
1160352398 18:78194777-78194799 AGGGACAGCTGGGGAAAGACTGG + Intergenic
1160960916 19:1720441-1720463 AGGAACTGCTGGGCAAAGGCTGG - Intergenic
1161233864 19:3188538-3188560 AAGGACTGCAGGGGAAAGGGAGG - Intronic
1161318073 19:3627581-3627603 ACGGACTTCAGGGGCAAGGCTGG + Intergenic
1161318869 19:3631951-3631973 CAGGGGTCCTGGGGAAGGGCAGG + Exonic
1161810136 19:6466772-6466794 GAGGACTTGTGGGGAGAGGCTGG + Intronic
1161851486 19:6740031-6740053 AAGGAATCCTGGGGCCAGGCCGG + Intronic
1162357417 19:10194776-10194798 ACGGACTCAGGGGGACAGGCAGG - Intronic
1162838077 19:13334660-13334682 CAGGACTTCTGGGAAAAGACTGG + Intronic
1162993590 19:14319339-14319361 AAGGACTCAGGGGGATAGGAGGG + Intergenic
1163439523 19:17314645-17314667 AGAGACACCTGGGGAAAGCCAGG - Intronic
1163755792 19:19105546-19105568 AAGGCCTCCTGGAGATAAGCGGG - Exonic
1164318580 19:24117380-24117402 AAGGAAGCCTGGGCAATGGCGGG + Intronic
1164333638 19:24285460-24285482 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1164371340 19:27646930-27646952 AGGGACTCCTGGGCAAATGCAGG - Intergenic
1164608430 19:29616441-29616463 GAGCCCTCCTGGCGAAAGGCAGG + Intronic
1164908072 19:31983874-31983896 TAGGACCCCTGGAGAAAGGCAGG + Intergenic
1165825419 19:38702967-38702989 AAGCACTCTCGGGGAAGGGCTGG - Intronic
1166235355 19:41451785-41451807 AGGGACTCCGGGGGAAAGGGTGG + Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166764462 19:45244670-45244692 AGGGACTCCGGGGAAAAGGCTGG - Intronic
1167442167 19:49514600-49514622 AAGGACCCCTGAGGAATGGGGGG - Intronic
1167724082 19:51199331-51199353 AGGGCCCCCTGGGGCAAGGCTGG + Intergenic
925374102 2:3369690-3369712 AAGCAATCCTGGGCAATGGCGGG - Intronic
925431652 2:3799929-3799951 AAGCAATCCTGGGCAATGGCGGG + Intronic
925855694 2:8127019-8127041 AAGGACTGATGGGGAGAGGAGGG + Intergenic
926650354 2:15337291-15337313 GAGGACTCAGGGGGAAAGGGTGG + Intronic
927016570 2:18969501-18969523 GAGGACACCAGAGGAAAGGCGGG + Intergenic
927307539 2:21590673-21590695 GAGGACTCCTGAGGACAGGAAGG + Intergenic
927499760 2:23574935-23574957 AAGGACTCCTGAGGAATGGGTGG + Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
928924655 2:36565495-36565517 AGGGACATCTGGGGAAATGCAGG - Intronic
931167222 2:59761158-59761180 AGGGAGTTCTGGGGATAGGCAGG - Intergenic
931207535 2:60162620-60162642 AAAGACTGCTTTGGAAAGGCAGG - Intergenic
932127379 2:69156339-69156361 AAGAACTTCTGTGGAAAGGGAGG - Intronic
932306586 2:70707937-70707959 CAGGACTGCTGGAGCAAGGCCGG - Intronic
932493267 2:72134457-72134479 AAGGCCATCTAGGGAAAGGCAGG - Intronic
932731065 2:74222288-74222310 GGGGACACCTGGGGAAAGGAGGG + Intronic
932903126 2:75723246-75723268 AAGGATCCGTGGGGAAAGCCTGG + Intergenic
934547470 2:95230206-95230228 GAGGACTCAGGGGGAAAGGGTGG + Intronic
934649653 2:96083648-96083670 ATGCACTCCTGGGGTAGGGCAGG - Intergenic
934766319 2:96882099-96882121 CAAGAGTCCTGGGGAAATGCAGG - Intronic
936497391 2:113034377-113034399 AGGGACTCTTGGAGATAGGCTGG - Intronic
936720185 2:115242156-115242178 GAGGACTCAGGGGGAAAGGGTGG - Intronic
936954265 2:118008933-118008955 AAGGAATCCAGGGAAAAGGAAGG + Intronic
937294589 2:120802157-120802179 ATGGACTCCTAGGGGAAGTCAGG - Intronic
937431991 2:121846539-121846561 AAAGACTCTAGGGGCAAGGCTGG + Intergenic
937571577 2:123369478-123369500 AAGGAATTCTGGGGGAAGGTGGG - Intergenic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
938537502 2:132257731-132257753 AGGGACGCCTGGGGAAGGGAGGG + Intronic
938912627 2:135899149-135899171 AAGCAGGCCTGGGGAAAGGAGGG + Intergenic
939045524 2:137245492-137245514 CAGCATTCCAGGGGAAAGGCAGG - Intronic
939107400 2:137964781-137964803 AAGCACTGCAGGAGAAAGGCAGG - Intronic
939485986 2:142811829-142811851 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
940011757 2:149061687-149061709 AAGGAATCCAGGGAAAAGGAGGG - Intronic
940919869 2:159294670-159294692 AAGGAAGCCTGGGCAATGGCAGG + Intergenic
941563393 2:167077649-167077671 ATGGACACCTGGGGAAAGTATGG + Intronic
942132415 2:172893259-172893281 GAGGATGCCTGGGCAAAGGCAGG + Intronic
942759970 2:179386202-179386224 AAGTGATCCTGGGCAAAGGCGGG - Intergenic
943318042 2:186413072-186413094 GAGGTCTCCTTGGGGAAGGCTGG + Intergenic
944257645 2:197640296-197640318 AAGGAAGCCTGGGCAATGGCGGG + Intronic
945645320 2:212484881-212484903 AAGGAGCCCTGGGAAAAGGCAGG - Intronic
946816374 2:223582537-223582559 AAGGGCTCCTGGGGAAACTGAGG - Intergenic
1168856079 20:1010011-1010033 TTGGCCTCCTGGGCAAAGGCAGG + Intergenic
1169278171 20:4247370-4247392 AATGAGTGCTGGGGAAAAGCGGG + Intronic
1169745028 20:8934965-8934987 AAGGGCCCCTTGGGAAAGGCTGG + Intronic
1171068793 20:22046148-22046170 AAGGAAGCCTGGGCAATGGCAGG + Intergenic
1171403021 20:24891817-24891839 TCGGGATCCTGGGGAAAGGCAGG - Intergenic
1171810971 20:29743920-29743942 AGGGACACCTGGGGAAGGGAGGG + Intergenic
1172002299 20:31788693-31788715 AAGGACTCCTGGGGCAGAGGTGG + Intronic
1172111494 20:32547961-32547983 AAGGATTCCTGGGGAGAGAGAGG - Intronic
1172175050 20:32967023-32967045 AGGGATTCCTGGAGAAAGGTGGG + Intergenic
1173709326 20:45140662-45140684 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
1174078195 20:47952737-47952759 GAGGGCTCCTGGGGACAGGGTGG - Intergenic
1174507099 20:51023710-51023732 CAGGACTTCCAGGGAAAGGCAGG - Intergenic
1175509236 20:59511195-59511217 GAGGACTCAGGGGGAAAGGGTGG - Intergenic
1176547243 21:8207311-8207333 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1176555148 21:8251520-8251542 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1176566194 21:8390358-8390380 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1176574068 21:8434544-8434566 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1177447653 21:21218567-21218589 AAGGACTCCTGGGGTTACACTGG - Intronic
1178823525 21:35996170-35996192 CGGGACTCGGGGGGAAAGGCTGG - Intronic
1179085110 21:38209200-38209222 AGGGGCTGCTTGGGAAAGGCTGG + Intronic
1179470470 21:41606743-41606765 AAGGACTCCTGGGAACAGAAAGG - Intergenic
1179717974 21:43299759-43299781 TCGAGCTCCTGGGGAAAGGCTGG - Intergenic
1180313117 22:11254376-11254398 AGGGACGCCTGGGGAAGGGAGGG + Intergenic
1180519506 22:16184162-16184184 AAGCAATCCTGGGCAATGGCGGG - Intergenic
1182573669 22:31258358-31258380 AAGGACTACTGGGGGAAGTTTGG + Exonic
1183090361 22:35518249-35518271 AGGGGCTCCTGAGCAAAGGCTGG + Intergenic
1183098763 22:35570597-35570619 GAGGCCTCCTGGGGAAGGGATGG + Intergenic
1183337801 22:37260612-37260634 CAGGGCTCCAGGAGAAAGGCAGG - Intergenic
1184125276 22:42482425-42482447 GAGGACGCCTAGGGAATGGCAGG - Intergenic
1184431415 22:44443380-44443402 ACCCACTCCTGGGGAAGGGCGGG + Intergenic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1185106880 22:48876221-48876243 AAAGAGTCCGGAGGAAAGGCTGG + Intergenic
1203252116 22_KI270733v1_random:123596-123618 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1203260170 22_KI270733v1_random:168679-168701 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
949225990 3:1696773-1696795 AGAGACTGCTGGGGAAAGGAAGG + Intergenic
949433800 3:4006475-4006497 AATTACTCCAGGGGAGAGGCTGG + Intronic
949531018 3:4955167-4955189 GAGGACTCTGGGGGAAAAGCTGG - Intergenic
950644810 3:14370873-14370895 CAGGCCTCCTGGGGCAGGGCAGG - Intergenic
950848263 3:16035680-16035702 TAGCACTCCAGGGGAGAGGCAGG + Intergenic
950962613 3:17121347-17121369 CAGGGCACCTGGGGAAAGTCTGG - Intergenic
951269146 3:20603458-20603480 AAGGTCCCCTGGGGAAATGTGGG + Intergenic
951544386 3:23810507-23810529 GAGGACGCCCGGGGAAAAGCAGG + Intronic
952407026 3:33014081-33014103 AAGGTGTCCTGGGGCAAGTCTGG + Exonic
953015834 3:39075328-39075350 AAGGACTGCTCAGGAAAGCCAGG - Intronic
953226216 3:41024071-41024093 AAGAACTCCTGTGGTAAGACTGG + Intergenic
953660881 3:44890746-44890768 CAGGTCTGCTGGGGAATGGCAGG + Intronic
954433302 3:50482779-50482801 AAGGAGCCCTGGGGAAGGGCAGG + Intronic
954627128 3:52028705-52028727 AAGGACCCATGGAGACAGGCTGG + Intergenic
955173504 3:56588290-56588312 GAGGACTTATGGAGAAAGGCTGG + Intronic
956084793 3:65597709-65597731 GAGGAAGCCTGGGGACAGGCAGG - Intronic
959023066 3:101210222-101210244 GAGGACTCAGGGGGAAAGGGTGG - Intergenic
959463772 3:106659437-106659459 GTGGACTCCAGGGGAAAGGTGGG + Intergenic
960094749 3:113678240-113678262 AAGGGCTGCAGGGGAAAGGCTGG - Intronic
961333085 3:126154388-126154410 TCTCACTCCTGGGGAAAGGCTGG + Intronic
961599663 3:128051223-128051245 AAGGACTACTGGGAACAGGCAGG - Intergenic
961739292 3:129022690-129022712 AGGCAGTTCTGGGGAAAGGCAGG - Intronic
962598251 3:136969258-136969280 AAGCAATCCTGGGCAATGGCGGG + Intronic
963139055 3:141932746-141932768 ACGGACTCTTGGGGAGAGGGAGG + Intergenic
963453531 3:145515675-145515697 GAGGTCTCCTTGGGAAAGGATGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965226951 3:166002188-166002210 AAGGTCTCCTTGGGGAAGGATGG + Intergenic
966823679 3:183945296-183945318 AGGGGTTCCTGGGGAAAGGTGGG + Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969222070 4:5767461-5767483 AAGGAAGCCTGGGCAATGGCGGG + Intronic
969315496 4:6379188-6379210 AAGCACTGCTGAGGAAAGCCGGG - Intronic
969378649 4:6780003-6780025 GAGGACTCCTGCGTTAAGGCAGG - Intergenic
969615629 4:8251109-8251131 AAGAACTCCTGAAGGAAGGCAGG + Intergenic
970133168 4:12893389-12893411 AAGAACTCCTTGGGGAAGGCAGG - Intergenic
970473648 4:16400961-16400983 AAGGTTTCCTGAGGCAAGGCAGG + Intergenic
970687505 4:18585404-18585426 GAGGACTCAGGGTGAAAGGCTGG - Intergenic
971385303 4:26136377-26136399 AAGGGCTCCTGGGGCAGGACTGG - Intergenic
972342681 4:38166080-38166102 TGGGCTTCCTGGGGAAAGGCAGG - Intergenic
973689383 4:53409676-53409698 AAGGAAGCCTGGGCAATGGCGGG + Intronic
974240433 4:59238745-59238767 AATGACTCCAGGGGAATGGGTGG - Intergenic
975937948 4:79604348-79604370 CAGGACCCATGGGGAATGGCAGG - Intergenic
976490732 4:85667184-85667206 AAGGAAGCCTGGGCAATGGCGGG + Intronic
977247068 4:94645072-94645094 CAGGACTCAAGGGGAAAGGATGG - Intronic
977486098 4:97648103-97648125 AAGTAATCCTAGGGGAAGGCTGG + Intronic
977619175 4:99117356-99117378 AAGCAATCCTGGGCAATGGCGGG + Intergenic
978736195 4:112086911-112086933 AAGGAAGCCTGGGCAATGGCGGG - Intergenic
978858004 4:113415121-113415143 GAGGACTCATGGGGAAAGGGTGG - Intergenic
978864782 4:113494701-113494723 AAGGAAGCCTGGGCAATGGCGGG + Intronic
979766814 4:124473167-124473189 AAGGTATCCTGGGGGAAGGATGG - Intergenic
980194765 4:129574205-129574227 AGGGACTCATGAGGAAAGGGTGG - Intergenic
980512422 4:133812079-133812101 AAGGATCCCTGGGAAAAGCCTGG - Intergenic
982870575 4:160574474-160574496 AAGCAATCCTGGGCAATGGCGGG - Intergenic
982950113 4:161683900-161683922 AGGGACTCAGGGGGAAAGACTGG - Intronic
983184867 4:164690149-164690171 AAGGTCTCCTTGGGGAAGGATGG - Intergenic
984127762 4:175833220-175833242 AAAGACTCCTGGGGGTGGGCGGG + Intronic
984521575 4:180808412-180808434 AAAGGCTCTTGGGCAAAGGCAGG - Intergenic
985639013 5:1054488-1054510 GAGGCCACCTGGGGAAACGCTGG + Intronic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
987160123 5:15133055-15133077 AGCGACTCCTGGGGAAGGGGTGG - Intergenic
988006309 5:25416296-25416318 AAGCATTCCTAAGGAAAGGCAGG - Intergenic
988267689 5:28972779-28972801 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
991336503 5:65553975-65553997 AAGGACTTCTGGGGTAAGACTGG - Intronic
992643456 5:78790193-78790215 ATGGCCTCCTGGAGAAGGGCTGG - Intronic
993652175 5:90535552-90535574 AAGGAGTCTTGGGGATTGGCAGG - Intronic
994015721 5:94962708-94962730 TGGGACTCAGGGGGAAAGGCTGG + Intronic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
997235650 5:132270739-132270761 AGGGATTTCTGGGGAAGGGCTGG - Intronic
998422681 5:142001985-142002007 AAGTACCCATAGGGAAAGGCAGG - Exonic
999114217 5:149148409-149148431 AAGGACTTCAGAGGAAAGGAGGG + Intronic
999203520 5:149832854-149832876 AGGGAGTCCCGGGGAGAGGCTGG - Exonic
999370369 5:151051633-151051655 AGAGACTCCTGGTGAAATGCAGG + Intronic
1000102338 5:158028179-158028201 ATGGCCTCCTGGGAAAATGCTGG + Intergenic
1000330230 5:160199849-160199871 AAGGACTGCTGAGGAGAGACAGG + Intronic
1001053545 5:168431373-168431395 AAGGTCTTCTGGTGAAGGGCTGG - Exonic
1001591123 5:172866215-172866237 AAGGCCAACTGGGGAGAGGCAGG + Intronic
1001600999 5:172928309-172928331 ATGGACAGCTGGGGAAGGGCTGG + Intronic
1001796639 5:174507597-174507619 AGGGACTCAGGGGGAAAGGGTGG - Intergenic
1002966278 6:1969717-1969739 AAGGCCTCTTGGGGGAAGGAAGG - Intronic
1003652720 6:7976126-7976148 TAGGATTCTTGGGGAAATGCAGG + Intronic
1003665954 6:8111536-8111558 GAGCACTTCTGGGGAAGGGCAGG - Intergenic
1004431670 6:15550729-15550751 AAGGACTCCTGGTGGAAGGAGGG - Intronic
1006016351 6:31084231-31084253 AAGGACTCATGGGACAGGGCAGG + Intergenic
1006077257 6:31541772-31541794 AAGAGCTCCTGGGGGAAGGAAGG - Intronic
1006753884 6:36397762-36397784 AATGACTCCTAGGCCAAGGCAGG + Intronic
1006836079 6:36999508-36999530 AAGGACTGGAGGGGACAGGCTGG - Intergenic
1007401659 6:41606038-41606060 CAGGACACCTGGGGACAGCCAGG + Intergenic
1007615386 6:43176698-43176720 TAGGCCTCGTGGGGGAAGGCAGG - Intronic
1007709079 6:43810289-43810311 AAGGGCTCCTGGGGCTGGGCTGG + Intergenic
1011093505 6:83633484-83633506 AAGGACCACTGGGCAAGGGCAGG + Intronic
1011196751 6:84788470-84788492 GGGGACTCATGGGGAAAGGGTGG + Intergenic
1011289594 6:85762866-85762888 GAGGACTCCAGGGGAAAGGGTGG - Intergenic
1012718959 6:102716551-102716573 CAGGACACCTGGGGATAGGAGGG + Intergenic
1012958109 6:105592562-105592584 GAGGAATCCTGGGAACAGGCAGG - Intergenic
1015467127 6:133559651-133559673 AAGGTCTCCTTGGGAATGGATGG + Intergenic
1015475566 6:133656064-133656086 GAGGTCTCCTTGGGAAAGGATGG - Intergenic
1015686747 6:135871608-135871630 AAAGAATTCTGGGGAAAGACAGG + Intronic
1015882018 6:137879230-137879252 ACGGACTCCTGGGGACAGGACGG + Exonic
1016162301 6:140897254-140897276 AAAGACTACTGGGAAAATGCAGG - Intergenic
1016239855 6:141917301-141917323 AAGGAAGCCTGGGCAATGGCGGG - Intergenic
1017228016 6:152042504-152042526 GAGGTCTCCTGGGGGAAGGATGG + Intronic
1017650461 6:156576623-156576645 ATGGACTCTTGGGGAAAAGAAGG - Intergenic
1017715668 6:157211033-157211055 ATGGACTTCAGGGCAAAGGCTGG - Intergenic
1018258095 6:161942169-161942191 AGGGGCCTCTGGGGAAAGGCTGG + Intronic
1018545953 6:164935810-164935832 AATGATTTCTGGGGAAAGGTGGG + Intergenic
1019840523 7:3438118-3438140 AAGCACTCTGGGGCAAAGGCAGG - Intronic
1020113415 7:5461059-5461081 CAGGACACCAGGAGAAAGGCTGG - Intronic
1020785922 7:12571872-12571894 AAGACCTCCTGGGGAGAGGCTGG - Intronic
1023127072 7:36965145-36965167 GAGAACTCATGGGGAAAGGATGG - Intronic
1023758838 7:43444946-43444968 AAGGACTCCTCGGAGAAGGATGG + Exonic
1023949099 7:44827395-44827417 AAGGACTCCTCGTGAAGAGCAGG + Intronic
1024022267 7:45383062-45383084 AAGCAATCCTGGGCAATGGCGGG + Intergenic
1025809110 7:64862947-64862969 CGGGACGCCTGAGGAAAGGCTGG - Intergenic
1026687174 7:72521291-72521313 AAGGACACCCAGGGAATGGCAGG + Intergenic
1026954868 7:74370770-74370792 AAGGACTCCTTGTACAAGGCAGG - Intronic
1027509393 7:79060713-79060735 AAAGACTCATGGGGTAAGTCAGG - Intronic
1027815355 7:82961702-82961724 GAGGAATCCTGGGAGAAGGCTGG + Intronic
1029419212 7:100463811-100463833 AAGGACAGCTGGGGAGGGGCTGG - Intronic
1031234834 7:119161439-119161461 AGGGACACCTGAGGAAAGGAAGG + Intergenic
1031400699 7:121323462-121323484 AAGGATTGCTGGGGAAATGCTGG + Intergenic
1031474643 7:122206760-122206782 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
1032173484 7:129605409-129605431 TAGGACTGCTAAGGAAAGGCTGG - Intergenic
1032881877 7:136099231-136099253 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1033344729 7:140518190-140518212 GAGGCCTCCTAGTGAAAGGCTGG - Intergenic
1033609695 7:142953714-142953736 AAGGAAACCTTGGGGAAGGCAGG - Intronic
1033891588 7:146019128-146019150 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1033966895 7:146986156-146986178 AGGGACTCATGGAGAAAGGGTGG - Intronic
1034431866 7:151045222-151045244 AAGAGCTCCTGAAGAAAGGCGGG + Exonic
1035025117 7:155820117-155820139 AAGGAGTCGTGGGGCAGGGCAGG - Intergenic
1035048591 7:155984886-155984908 GGGGACCTCTGGGGAAAGGCAGG - Intergenic
1035531645 8:356947-356969 GAGGACTCAGGGGGAAAGGGTGG - Intergenic
1036004448 8:4645781-4645803 AAGGACAACAGGGTAAAGGCAGG - Intronic
1036667472 8:10756922-10756944 TAGGAGTCCTGGGCAAGGGCAGG + Intronic
1037252086 8:16907582-16907604 AAGAACTCCTGGCTAAATGCTGG + Intergenic
1037900862 8:22688527-22688549 AAGGACTCTAGTGGAAAGGGGGG - Exonic
1037916199 8:22774937-22774959 AGGGGCTCCTGGGGAAGAGCTGG - Intronic
1040392295 8:46960626-46960648 GGGGACTCATGGGGAAAGGGTGG - Intergenic
1041152095 8:54945221-54945243 AGGGATTCCTGGGGAAAGGGGGG - Intergenic
1042159483 8:65877852-65877874 AAGGACCTCTCAGGAAAGGCTGG - Intergenic
1042724613 8:71860288-71860310 AAGGACTGCTTCTGAAAGGCAGG + Intronic
1042994365 8:74679247-74679269 AGGGACTCAAGGGGAAAGGTAGG - Intronic
1043397435 8:79852791-79852813 AATGACTCAGGGGGAATGGCTGG - Intergenic
1043600312 8:81929266-81929288 AAATACTCCCTGGGAAAGGCTGG - Intergenic
1043877133 8:85498250-85498272 AGGGACTCAGGGGGAAAGGGTGG + Intergenic
1044173149 8:89081889-89081911 AAGGTCTCTTGGGTAAAGGTTGG - Intergenic
1045847658 8:106657521-106657543 CAGGACTGCAGGGGAAAGGGTGG - Intronic
1046086492 8:109443308-109443330 AAGGATTCTGGGGGAAAGACTGG - Intronic
1046973083 8:120244539-120244561 GGGGACTCCAGGGGAAAGGGTGG - Intronic
1047231609 8:123002354-123002376 AAGTCCTCGTGGGGAGAGGCAGG - Intergenic
1047611367 8:126523928-126523950 CAGGACTCAGGGGGAAAGGGTGG + Intergenic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1048438881 8:134445158-134445180 AAGGAGCCCTTGGGAAAGGCAGG + Intergenic
1049092628 8:140527980-140528002 AAGGCCTCCTGGGGACACTCCGG + Intergenic
1049127448 8:140804813-140804835 GTGGCCTCCCGGGGAAAGGCAGG - Intronic
1050663456 9:7909009-7909031 GGGGACTCTTGGGGAAAGGGTGG + Intergenic
1050799781 9:9595781-9595803 GAGGACTCAGGGGGAAAGGGTGG + Intronic
1051458744 9:17290570-17290592 AAGGAAGCCTGGGCAATGGCGGG + Intronic
1051795257 9:20860936-20860958 AAGTATTGGTGGGGAAAGGCTGG - Intronic
1052083014 9:24230214-24230236 AAGCAATCCTGGGCAATGGCGGG + Intergenic
1052239093 9:26250215-26250237 AAGCAATCCTGGGCAATGGCAGG - Intergenic
1052955187 9:34248707-34248729 AAAGTCTGCTGGGGAAAGCCAGG - Intronic
1053062594 9:35043725-35043747 AAGGACTTCTGGGGAACCGTGGG + Exonic
1056001990 9:82227560-82227582 AAGTACCCCGGGGGAAGGGCAGG - Intergenic
1056198251 9:84249582-84249604 AAGGAGGCCTGGGGAAGGCCAGG + Intergenic
1057717500 9:97506097-97506119 AAGAACAGCAGGGGAAAGGCAGG - Intronic
1059127006 9:111698723-111698745 TAGTATTCCTGGGGGAAGGCAGG + Intronic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1060668363 9:125447189-125447211 AATGAGCCCTGGGGATAGGCAGG - Intronic
1060986822 9:127824879-127824901 AAGGCCTCCTGGGGGAGGCCCGG - Exonic
1061180293 9:129021556-129021578 CAGGACTTCCGGGGAAAGGAGGG - Intronic
1061201418 9:129140596-129140618 AAGGGCTCCGAGGCAAAGGCAGG - Intronic
1061888885 9:133607312-133607334 AAGGGCACCTGGGGAAAGGTGGG - Intergenic
1062045767 9:134423809-134423831 AAGGACCACTGGGGTCAGGCAGG - Intronic
1062284040 9:135765250-135765272 AAGCAGTCCTGGGGAGAGGATGG - Intronic
1062284071 9:135765371-135765393 AAGCAGTCCTGGGGAGAGGATGG - Intronic
1203468519 Un_GL000220v1:106746-106768 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1203476340 Un_GL000220v1:150718-150740 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1186348816 X:8722357-8722379 GGGGACTCCGGGGGAAAGGGTGG - Intronic
1186880472 X:13860785-13860807 GGGGACTCGGGGGGAAAGGCTGG - Intronic
1187467495 X:19540215-19540237 AAGGAATCCTGGGGCCAGCCAGG - Intronic
1189733459 X:44045886-44045908 GGGGACTCCGGGGGAAAGGGTGG - Intergenic
1190242563 X:48668742-48668764 AAGGAGTCCTGGGGAAAGTGAGG + Intergenic
1190949333 X:55127496-55127518 AAGGATACCAGGGGAAAGGAGGG - Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1192185871 X:68946506-68946528 AAGGACAGCTGGGGAAAGTGGGG + Intergenic
1192419957 X:71020827-71020849 AGGGACTCAGGGGGAAAGGGTGG - Intergenic
1193550890 X:82891413-82891435 AGGGACTCAGGGGGAAAGGGTGG + Intergenic
1194265900 X:91753244-91753266 AAGGAAGCCTGGGCAATGGCGGG - Intergenic
1194271832 X:91825236-91825258 AAGGAAGCCTGGGCAATGGCGGG + Intronic
1194303555 X:92215507-92215529 AAGGAAGCCTGGGCAATGGCGGG - Intronic
1194306499 X:92255995-92256017 AAGGAAGCCTGGGCAATGGCGGG + Intronic
1194527881 X:95001991-95002013 GAGGACTCAGGGGGAAAGGGTGG - Intergenic
1194836885 X:98693061-98693083 AAGGAAGCCTGGGCAATGGCGGG + Intergenic
1195383904 X:104295848-104295870 CAAGAATGCTGGGGAAAGGCAGG + Intergenic
1195504943 X:105646136-105646158 TAGCACTCCAGGGTAAAGGCAGG + Intronic
1195848024 X:109249253-109249275 AATGAAACTTGGGGAAAGGCTGG + Intergenic
1196288492 X:113911234-113911256 GAGGACTGCTGGGGAAAGGCAGG + Intergenic
1197475761 X:126923061-126923083 GAGGACTCATGGGGAAAGAGTGG - Intergenic
1197870314 X:131057984-131058006 AAGGGCTCCTGGGGTGGGGCTGG + Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198431947 X:136576320-136576342 AAGGGCACCTGGGGAAAGAGTGG - Intergenic
1199711240 X:150470969-150470991 AAGGACTGCTGTGGCAAGCCTGG - Exonic
1200070951 X:153529103-153529125 CAGGTCACCTGGGGAAAGCCTGG - Intronic
1200589081 Y:5046673-5046695 AAGGAAGCCTGGGCAATGGCGGG + Intronic
1200708475 Y:6463100-6463122 AAGGGCTCTTTGGGAAAGGCAGG + Intergenic
1200709329 Y:6469429-6469451 AGGGGCTCTCGGGGAAAGGCAGG + Intergenic
1200936741 Y:8744844-8744866 AGGGGCTCTTGGGGAAAGGCAGG + Intergenic
1200962860 Y:9011144-9011166 AGGGGCTCTTGGGGAAAGGCTGG - Intergenic
1200984705 Y:9292673-9292695 AAGGGCTCTCTGGGAAAGGCAGG + Intergenic
1201024783 Y:9695279-9695301 AGGGGCTCTCGGGGAAAGGCAGG - Intergenic
1201025637 Y:9701608-9701630 AAGGGCTCTTTGGGAAAGGCAGG - Intergenic
1201076841 Y:10195723-10195745 AGGGACGCCTGGGGAAGGGAGGG - Intergenic
1201418854 Y:13776268-13776290 AAGCAAGCCTGGGGAATGGCGGG + Intergenic
1201604555 Y:15770961-15770983 CAGGACTTCCGGGGAAAGGAGGG + Intergenic
1202129345 Y:21596026-21596048 AGGGGCTCTTGGGGAAAGGCTGG - Intergenic
1202150244 Y:21837637-21837659 AAGGGCTCCCAGAGAAAGGCTGG + Intergenic