ID: 1184840348

View in Genome Browser
Species Human (GRCh38)
Location 22:47048811-47048833
Sequence TAGGGGTGAGGGGCCCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 313}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184840337_1184840348 28 Left 1184840337 22:47048760-47048782 CCAGCTCTGGGGGGAGGTGGGGC 0: 1
1: 1
2: 9
3: 60
4: 685
Right 1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG 0: 1
1: 0
2: 4
3: 29
4: 313
1184840342_1184840348 -5 Left 1184840342 22:47048793-47048815 CCGTAATCAGGAGCAATGTAGGG 0: 1
1: 0
2: 0
3: 13
4: 101
Right 1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG 0: 1
1: 0
2: 4
3: 29
4: 313
1184840340_1184840348 0 Left 1184840340 22:47048788-47048810 CCGCACCGTAATCAGGAGCAATG No data
Right 1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG 0: 1
1: 0
2: 4
3: 29
4: 313
1184840335_1184840348 29 Left 1184840335 22:47048759-47048781 CCCAGCTCTGGGGGGAGGTGGGG 0: 1
1: 0
2: 10
3: 82
4: 912
Right 1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG 0: 1
1: 0
2: 4
3: 29
4: 313
1184840339_1184840348 4 Left 1184840339 22:47048784-47048806 CCTGCCGCACCGTAATCAGGAGC 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG 0: 1
1: 0
2: 4
3: 29
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184840348 Original CRISPR TAGGGGTGAGGGGCCCTGCA CGG Intronic
900646462 1:3711011-3711033 TTGGTGAGAGGGACCCTGCATGG + Intronic
900942392 1:5808392-5808414 TTGGGGTGAGGGTCCCTCCTTGG + Intergenic
900990811 1:6097359-6097381 TAAGAGTGAGAGGCCCTGCTGGG + Intronic
901158217 1:7154888-7154910 GAGTGGGGAGGGGCTCTGCAGGG - Intronic
901343987 1:8522592-8522614 TAGGTGTGAGCCGCCCTGCCCGG - Intronic
901451233 1:9338118-9338140 GAGGGGACAGGGGACCTGCAGGG - Intronic
901511224 1:9718970-9718992 GAGTGGTGAGTGGCCCAGCAAGG - Intronic
901757417 1:11449720-11449742 CACGGGTGAGGGTCTCTGCAGGG - Intergenic
901956198 1:12787525-12787547 TTGGGGTTGGGGGCCCTACATGG + Intergenic
902021739 1:13351108-13351130 TTGGGGTTGGGGGCCCTACATGG - Intergenic
902458633 1:16554411-16554433 GAGGGGTGAGGGCCCATGGAAGG + Intergenic
902493524 1:16853505-16853527 GAGGGGTGAGGGCCCATGGAAGG - Intronic
902728144 1:18350889-18350911 TGGGGGGTAGGGGCTCTGCAGGG + Intronic
903151818 1:21415171-21415193 GAGGGGTGAGGGCCCATGGAAGG + Intergenic
903222229 1:21875368-21875390 GAGGGGGGAGGGGCCATGCAGGG - Intronic
903476230 1:23620781-23620803 AAGGGCTGCGGGGGCCTGCAAGG - Intronic
904266065 1:29319178-29319200 GAGGGGTCAGGGGTCCTGGAGGG + Intronic
904352208 1:29915853-29915875 CAGAGGTGAGGAGCCATGCAGGG - Intergenic
904413828 1:30342797-30342819 TTGCGGTGAGGGGCCCTCCTGGG - Intergenic
905629427 1:39510583-39510605 TCAGGGAGACGGGCCCTGCAGGG - Intronic
905668331 1:39775610-39775632 TCAGGGAGACGGGCCCTGCAGGG + Intronic
905886999 1:41496819-41496841 AAGGGGTGACGGGCCCCACACGG - Intergenic
906408672 1:45562039-45562061 GTGGGCTGAGGGGCCCAGCAGGG + Intronic
907498298 1:54860051-54860073 TAGGGGTGAGGGTCTCATCATGG - Intronic
908916228 1:69129649-69129671 GAGGGGTGAGGGGCACTGGGAGG + Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
914447236 1:147760364-147760386 TAGGGGTGAGGGGACATGTAGGG - Intronic
914917896 1:151829593-151829615 GAGGAGAGAGGGGCACTGCAGGG - Intronic
915313436 1:155015824-155015846 AAGGGGGGAAGGGCCCGGCAGGG + Intronic
915736976 1:158091259-158091281 TAGGGGTGAGGGTGCCTTGAGGG + Intronic
915741234 1:158120032-158120054 TCGGGGTCAGGGGCACTGAAGGG - Intergenic
915839229 1:159201812-159201834 TAAGAGTGAGGGGCCCCTCAGGG - Exonic
916497299 1:165356949-165356971 TCGGGGTGAGGGGCACTGGGGGG - Intergenic
917602414 1:176589952-176589974 TAGGGCTGAGGGTCCCTCCTGGG + Intronic
918161875 1:181908815-181908837 TATGGGTGAGGTGCCCAGCCAGG + Intergenic
919847960 1:201653499-201653521 TGGGGGGGAGGGGCAGTGCAAGG + Intronic
920191177 1:204194888-204194910 CTGGGGGAAGGGGCCCTGCAGGG + Intronic
920401704 1:205680347-205680369 CAGGGGTGAGGGTCCCGGCGCGG - Intronic
920444281 1:206003608-206003630 TATGGGTCAGGGGGCCTGCAGGG + Intergenic
922030217 1:221790439-221790461 TAGGGGGAGGGGCCCCTGCATGG - Intergenic
922062836 1:222108122-222108144 CAGAGCTGAGGGGCCCTGCTAGG + Intergenic
922301548 1:224305818-224305840 CAGGCGTGAGCCGCCCTGCACGG + Intronic
922326761 1:224535596-224535618 CAGGGGTGTGGGGAACTGCATGG + Intronic
922717414 1:227884766-227884788 CAGGAGTGATGGCCCCTGCAGGG - Intergenic
923949129 1:238927219-238927241 TAGGGGTCAGGGGCCCTCTGAGG - Intergenic
1062989030 10:1798627-1798649 CAGGTGAGAGGGGCCCTCCATGG - Intergenic
1066657023 10:37705595-37705617 CAGGGCTGAGGGGAGCTGCAGGG - Intergenic
1067161348 10:43827336-43827358 CAGGGGTGAGGGGCAATGCCAGG - Intergenic
1067745684 10:48933983-48934005 CAGGGCTCAGGGGCCCTGCAGGG + Intronic
1069750322 10:70741225-70741247 TAGGGGTAGGAGGCCCTGCCTGG - Intronic
1069858950 10:71458295-71458317 CATGGGTGAGGGGACCTTCAAGG - Intronic
1070704002 10:78624437-78624459 GAGGAGTGAGGAGCTCTGCAGGG + Intergenic
1070797631 10:79226123-79226145 AAGGGCTGTGTGGCCCTGCACGG - Intronic
1072660330 10:97359990-97360012 TTGGGGGCAGGGGTCCTGCAAGG + Intronic
1075674955 10:124289888-124289910 TTGGGTTGAGAGGCCCTCCAGGG - Intergenic
1075856149 10:125631849-125631871 GAGTGGTCAGGGGCCATGCAGGG + Intronic
1076250792 10:128982496-128982518 GAGGAGCGAGAGGCCCTGCAGGG - Intergenic
1076258553 10:129047874-129047896 TAGGGGTGAGCAGCCCTTTAAGG + Intergenic
1076361737 10:129894474-129894496 CAGGGGAGAGGCCCCCTGCAGGG + Intronic
1076510926 10:131013052-131013074 GAGGGCTGAGGAGCCCAGCAGGG - Intergenic
1077151673 11:1075608-1075630 GAGGGGTGAGTGGCCCCGGAGGG - Intergenic
1077441751 11:2572125-2572147 TAGGGGTGCGGGGCCCAGGTTGG + Intronic
1081618361 11:44603759-44603781 TAGAGGTCAGGAGTCCTGCAGGG - Intronic
1081741760 11:45445927-45445949 GAGGGGAGAAGGGCACTGCAGGG - Intergenic
1081910480 11:46696898-46696920 TATGGCTGAGGGGCCCAGCTGGG + Intronic
1084007480 11:66331068-66331090 CAGGGGTGAGGGCGCCTCCAAGG - Intronic
1084113245 11:67026874-67026896 TAGGGGTTAGGGGGTCTGTATGG + Intronic
1085076505 11:73597349-73597371 TGGGGGTGAGGGGCTTGGCATGG - Intronic
1086319225 11:85627948-85627970 TCGGGGTGGGGGGCACTGCAAGG - Intergenic
1090401535 11:126452593-126452615 TCCTGGTGAGGGGCCCTGGAAGG - Intronic
1090658665 11:128865011-128865033 GAGGGGTGAGGGAAGCTGCAGGG - Intronic
1090829339 11:130410085-130410107 GAGGTGTGAGGGGACCTGCCAGG - Intronic
1091670892 12:2451581-2451603 TGGGAGGGAGGGGCCCTGCCTGG + Intronic
1091803348 12:3339000-3339022 AAGGGGTCAGGGCCCCTGAAAGG + Intergenic
1094359558 12:29615608-29615630 GATGGATGAGGGACCCTGCAAGG - Intronic
1096146792 12:49284065-49284087 TGGGGGTGAGGGGCTGTGCCTGG + Intergenic
1101211028 12:102535142-102535164 GTCGGGTGAGGGGCCCGGCAAGG + Intergenic
1102505114 12:113379657-113379679 CAGGGGTGAGGGTACCTGCCGGG + Intronic
1103122023 12:118388522-118388544 TAGTGGTGAGGGGAGCTGCTAGG + Intronic
1103996591 12:124834151-124834173 GGGGCCTGAGGGGCCCTGCAAGG + Intronic
1104355495 12:128081404-128081426 TATGGTTGAGGGGCCTGGCACGG - Intergenic
1107777820 13:43865061-43865083 TATGTGGGAGGGGGCCTGCAAGG - Intronic
1113055581 13:106263434-106263456 CAGGGGTCAGGGGCCACGCAAGG - Intergenic
1113162006 13:107392274-107392296 CCAGGGTGAGGGCCCCTGCAAGG - Intronic
1114046504 14:18880753-18880775 TTGGGGCGCGGGGCACTGCAGGG + Intergenic
1114117708 14:19638697-19638719 TTGGGGCGCGGGGCACTGCAGGG - Intergenic
1116962265 14:50978456-50978478 AAGGCATGAGGGGCCTTGCATGG - Intronic
1117457721 14:55914413-55914435 TTGGGTTGAGGGGCACTGCATGG - Intergenic
1117802937 14:59464123-59464145 GAGGAGCGAGGGGGCCTGCATGG + Exonic
1119667754 14:76497277-76497299 TGGGGGTGAGTGTCCTTGCAGGG - Intronic
1119675050 14:76547323-76547345 TAGGGGTTAGGGGGCTTGGAGGG - Intergenic
1121087179 14:91155530-91155552 TAGGAGTGAGCCGCCGTGCAAGG - Intronic
1122972038 14:105156239-105156261 TAGGGGCTAGGGGCCCTGCAGGG + Intronic
1124362822 15:29051314-29051336 ATGGGGTGACGGGCCCTGCAGGG + Intronic
1124641807 15:31400593-31400615 TGGGGGTGAGGTGCCCTGCAGGG + Intronic
1125486538 15:40115167-40115189 TAGGGCTGACGGGCCGGGCATGG + Intergenic
1126800499 15:52293464-52293486 AAGGGGTGAGGGGGCTTCCAAGG - Intronic
1127397441 15:58553851-58553873 TAGGATTGAGGGGCCCAGGATGG - Intronic
1128341571 15:66825978-66826000 ACGGGCTGAGGGGACCTGCATGG + Intergenic
1128519955 15:68368676-68368698 CAGAGGTGAGGGGACCTGCCCGG - Intronic
1129252837 15:74318347-74318369 GAGGGCTGTGGGGCCCTTCAGGG - Intronic
1129677230 15:77638253-77638275 TAGTGCTGAGGGGCCCTTTACGG - Intronic
1129697033 15:77746615-77746637 TGGGGGCGAGGAGCCCTGCCTGG + Intronic
1129906977 15:79195384-79195406 GAGGAGGGAGGTGCCCTGCAAGG - Intergenic
1131668740 15:94597417-94597439 TATGGGTGAGGGTCTCAGCATGG + Intergenic
1132112522 15:99112626-99112648 CAGGGGTGAGGGGAGCTGCGAGG + Intronic
1132371262 15:101301004-101301026 TAGTGGTGAGGGGCTTTGGATGG + Intronic
1132463447 16:66837-66859 CATGGGTGAGGGGCCCTGGAGGG - Intronic
1132747985 16:1444856-1444878 TCGGGGTGAGGGGCACAGCCGGG + Intergenic
1133230989 16:4366399-4366421 CAGGGCTGAGGGGCTGTGCAGGG - Intronic
1133297664 16:4762811-4762833 GAGGGGTGTGGGGCCCTGCGGGG - Intronic
1133354363 16:5125112-5125134 TAGGGGTGAGCCACCCTGCCTGG + Intergenic
1133406233 16:5526709-5526731 TGGGGGAGAGGGGCACAGCAGGG - Intergenic
1133924257 16:10181153-10181175 TAGGGGTGAAGGACTCTCCACGG - Intronic
1134412323 16:14013210-14013232 CAGGGATGAGGGGCACAGCATGG + Intergenic
1136516531 16:30771981-30772003 CAGGGGTGAGGGGCCAGGCCAGG + Intronic
1136628020 16:31473508-31473530 GAGGGGTGAGAGGCTCCGCAGGG - Exonic
1137626878 16:49914678-49914700 TAGTGGGGAGGGCTCCTGCATGG + Intergenic
1137796505 16:51224639-51224661 TGGGGGTGAGGGACCCTCCAAGG - Intergenic
1138287369 16:55820714-55820736 TGGGTGTGAGGGGTCCTGCTGGG - Intronic
1138405155 16:56786803-56786825 TAGGTTTGAGGGGTCCTGCAGGG + Intronic
1140239006 16:73184248-73184270 TAGAGGTGTGGGCCCCTGCCTGG - Intergenic
1141680637 16:85541739-85541761 CAGGGGGAAGGGGCCCTGCATGG + Intergenic
1142276698 16:89122510-89122532 TTGGGGGCAGGGGCACTGCAGGG - Intronic
1142744321 17:1948141-1948163 CAGGGCTGAGGGTCCCTGCCAGG + Intronic
1142846945 17:2685984-2686006 TAGAGATAAGGGGCCCTGCCGGG + Intergenic
1144621001 17:16818523-16818545 TCGGTGGGAGGAGCCCTGCAGGG + Intergenic
1145694951 17:26780355-26780377 TATGGGTGAGGGAGCATGCAAGG - Intergenic
1146787468 17:35732061-35732083 TGGGGGTGGGGGTGCCTGCAAGG + Intronic
1147046006 17:37752652-37752674 TGGGGGTGAAGAGCCATGCAGGG + Intergenic
1147167521 17:38601420-38601442 TGGGTGTGAGGGGCAGTGCAAGG + Intronic
1147422707 17:40330607-40330629 TGTGGGTGAGAGGCCCTCCAAGG + Intronic
1148215487 17:45831858-45831880 TGGAGGGGAGGGGGCCTGCACGG + Intronic
1151306087 17:73263423-73263445 GAGGCATGAGGGGCCCAGCAGGG + Intergenic
1151463987 17:74272834-74272856 TGGGGTTGAGAGTCCCTGCAGGG - Intergenic
1152329002 17:79659812-79659834 GAGGGAAGAGGGGCCCTCCAGGG - Intergenic
1152565147 17:81097068-81097090 CACAGGTGAGAGGCCCTGCAAGG - Intronic
1152646527 17:81471448-81471470 TAGGGGAGAGGGGCTCTGGGAGG - Intergenic
1152727646 17:81955674-81955696 CTGGGGTGGGGGGCACTGCAGGG - Intronic
1152727663 17:81955721-81955743 CTGGGGTGGGGGGCACTGCAGGG - Intronic
1152799316 17:82323579-82323601 GAGGGGTCAGTGGCCCCGCACGG + Intronic
1152807939 17:82366037-82366059 GAGAGGTGGGAGGCCCTGCAGGG + Intergenic
1152861551 17:82699078-82699100 GAGGGGCGAGGGGCGGTGCAGGG + Intergenic
1157746348 18:50139211-50139233 GAGATGTGGGGGGCCCTGCAGGG + Intronic
1159888458 18:73933012-73933034 TAGGGGTGAAGCCCACTGCATGG - Intergenic
1160581873 18:79887730-79887752 CAGGTGGGAGGGGCTCTGCAGGG + Intronic
1161209912 19:3061243-3061265 TAGGTGCGAGGAGCCCTGTAGGG + Exonic
1161592539 19:5135313-5135335 TAGGGGAGAGGCGACCTTCAGGG - Intronic
1161993488 19:7698552-7698574 GTGGGGTGAGGGGCTCTGGAGGG + Intronic
1162028317 19:7906396-7906418 GCTGGGTGAGCGGCCCTGCAGGG + Intronic
1162766378 19:12922441-12922463 TAGGGGTGAGGGGTCTTGTTGGG - Intergenic
1162806279 19:13139435-13139457 CAGGGGTGGGGGGCCTTGGAAGG + Exonic
1163386123 19:17001601-17001623 TAGGGGTGAGGACACCAGCATGG + Intronic
1163762507 19:19145418-19145440 AAGGCGGGAGGAGCCCTGCAGGG - Intergenic
1164669948 19:30066816-30066838 ATGGGGTGGTGGGCCCTGCATGG + Intergenic
1165076423 19:33282159-33282181 GACGGGTCAGGGGCCCTCCAGGG - Intergenic
1166015990 19:39979860-39979882 TCTGGGTGAGGGCCCCCGCATGG + Exonic
1166229021 19:41414790-41414812 TGTTGGTGTGGGGCCCTGCATGG + Intronic
1166322091 19:42024819-42024841 AAGGTGTGAGGAGCCCTGGAGGG - Intronic
1167628366 19:50607292-50607314 TAGGGGTGAGGCACCTTGCCTGG + Intergenic
1168618959 19:57861603-57861625 CAGGGGTGAGGCACCCTGCCTGG + Exonic
1168683973 19:58336798-58336820 TAGTGGTTAGTGGCCCTGGAAGG + Intronic
925456652 2:4022006-4022028 TATGGGTGAGGGGCCAGGGATGG + Intergenic
927475309 2:23410080-23410102 TAGGAGGGAGAGGCCATGCAGGG + Intronic
927885851 2:26718062-26718084 TAGGGGCGAGGGGCCGAGAAAGG - Intronic
927932072 2:27051789-27051811 GAGAGGTGAGGGGCTCTGCGCGG + Exonic
927981696 2:27378563-27378585 GAGGAGTGGGGGGCCCTGCGTGG + Exonic
928411526 2:31058033-31058055 TAGGGCTGAGGGGCAGGGCAGGG - Intronic
928605504 2:32942019-32942041 TAGGGGTGGGGGGCCAGGCGCGG - Intergenic
930094873 2:47559327-47559349 TAGGAGTGGGGAGCCCAGCAGGG + Intronic
931429539 2:62197180-62197202 TGGGCGTGGGGGGCCCTGCCGGG + Intronic
932463084 2:71895917-71895939 AGGGGGTGAGGGGCCTGGCAAGG - Intergenic
932632900 2:73361952-73361974 TAGTGGTGTGGGACCCTCCATGG + Intergenic
932697449 2:73968627-73968649 TAGAGGTGAAGGGCACTCCAGGG - Intergenic
932882417 2:75516063-75516085 GAGGGGCCAGGGGCCCTGCGGGG + Intronic
933800917 2:85959760-85959782 TAGAGGTGAGGGGATCTGAATGG - Intergenic
934561247 2:95314666-95314688 GTGGTGTGAGGGGCCCAGCATGG + Intronic
934856894 2:97735183-97735205 TGGGGGTGTGGGGCCGAGCAGGG + Intronic
936416743 2:112322331-112322353 CAGGGGTGGGGGGCGGTGCAGGG - Intronic
937306116 2:120872041-120872063 GGCGGGTGAGGGGCCCTGGAAGG + Intronic
938236732 2:129711606-129711628 TATTGGTCAGGGTCCCTGCAGGG + Intergenic
938404930 2:131026824-131026846 TAGGTGTGTGTGGCCCTGCTGGG - Intronic
938943586 2:136190799-136190821 TAGGGGTGAGGGGACCTGTGGGG + Intergenic
940270240 2:151882342-151882364 TAGAGGTGAGAGGCTGTGCATGG - Intronic
940879551 2:158933140-158933162 AAGGGGTGAAGGCCCCAGCAAGG - Intergenic
946208636 2:218129466-218129488 TGAGGGTGAGGGGCCCACCAAGG - Intronic
946277938 2:218644644-218644666 TGGGGGTGTTGGGCCCTGCATGG + Exonic
946370582 2:219279309-219279331 TGGGGGGGTGGGGGCCTGCAGGG - Exonic
948232967 2:236365468-236365490 CAGCGGTCAGGGGCCCTGAAAGG + Intronic
948570257 2:238913279-238913301 GTGGGGTGAGGGGACCTGGAGGG + Intergenic
948906641 2:240982820-240982842 TGGGGGTGGGAGGCCCTGCAGGG - Intronic
1169136911 20:3203193-3203215 TAGGTGAGAGGGGCCCAGCCTGG - Exonic
1172047313 20:32089644-32089666 TGGGGGTGAGAGGAGCTGCAAGG - Intronic
1172057149 20:32162124-32162146 TGGAGGTGAGGGGCCCAACAGGG - Intronic
1172699760 20:36845835-36845857 TGGGGGTGGGGGGCCCTGGGAGG + Intronic
1172978983 20:38926921-38926943 GAGAGGTGAGCGGCCCTCCAGGG + Exonic
1173145240 20:40519287-40519309 TGGGGCTGAGTGGCCTTGCAGGG - Intergenic
1173669264 20:44786384-44786406 GAGGGGTGACTGGCCCTGCCTGG - Intronic
1173872922 20:46352841-46352863 TAGAGGGGGGTGGCCCTGCATGG + Intronic
1174394570 20:50238902-50238924 CAGGGCTGCGGGGCCCTGCTGGG + Intergenic
1175304487 20:57966539-57966561 TGGGGGTGCAGGGCCGTGCATGG - Intergenic
1175484229 20:59333505-59333527 TGGGGGTGAGGGGCCCAGCGGGG + Intergenic
1175859926 20:62144359-62144381 TAGTGGTGAGGGGCCCGGGTCGG + Intronic
1175921044 20:62450838-62450860 GAGGGGTGGGGGGACCTGGAAGG - Intergenic
1175926016 20:62472034-62472056 AAGGGGTTAGGGGCCAGGCACGG - Intronic
1176200354 20:63857665-63857687 TTGGGGTCAAGAGCCCTGCAGGG - Intergenic
1179986532 21:44924891-44924913 TAGGGGTGTGTGGGTCTGCAGGG - Intronic
1180258068 21:46647640-46647662 CAGGGGTGAGGCACCCTGCCTGG + Intronic
1180535370 22:16390314-16390336 TTGGGGTGTTGGGCCCTGGAGGG + Intergenic
1181130231 22:20726880-20726902 AAGGAGTGAGGGACCCTCCACGG + Intronic
1181638978 22:24187088-24187110 TGTGGGTGAGGGCACCTGCAGGG - Intronic
1182821708 22:33222287-33222309 TAGGGGTGAGGGGTCTAGAAGGG + Intronic
1182944087 22:34305769-34305791 TAGGAGTCAGGGGCCAGGCATGG + Intergenic
1183574968 22:38682194-38682216 GCGGGGTTAGGGGCCCTGCTGGG + Intronic
1183749748 22:39713102-39713124 GAGGGGGGAGAGGCCCTGCTTGG + Intergenic
1184557551 22:45241212-45241234 GAGGGGAGAGGTGCCCTGAAGGG - Intergenic
1184748311 22:46469424-46469446 TGGGAGTGAGGGGCTCAGCATGG - Intronic
1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG + Intronic
1185038646 22:48492665-48492687 CAGGGGAAAGGGGCCCTGGATGG + Intronic
1185342803 22:50299240-50299262 TAGGGCTGTGCGGCCCTCCAGGG + Intronic
949505599 3:4724741-4724763 AAGGGGTGAGAGGGCATGCAGGG - Intronic
950189582 3:10967237-10967259 GAGGGGTGAAGGGCATTGCAGGG + Intergenic
951825599 3:26864953-26864975 TAGGGGTGAGAGAACCTGGAAGG - Intergenic
954116166 3:48468014-48468036 GTGGGGTGTGGGGCCCTGGATGG - Exonic
954144126 3:48625916-48625938 TAGGGGTGAGGGGCTTCTCAAGG + Exonic
954316780 3:49805789-49805811 AAGGTGTGAGGGGCCCAGAATGG + Intronic
954794535 3:53154880-53154902 GAGGTGTAAGAGGCCCTGCATGG + Intergenic
957239418 3:77639118-77639140 TAGGGGAAAGGGGCCGGGCATGG - Intronic
959343152 3:105157201-105157223 GAGGGGTGGGGGGCCCACCAAGG - Intergenic
960874385 3:122282504-122282526 TAGAGTTTAGTGGCCCTGCATGG + Intronic
960937213 3:122911576-122911598 GAGAGGAGGGGGGCCCTGCAGGG + Intronic
961110655 3:124280398-124280420 TATGGGAGAGCTGCCCTGCAGGG - Intronic
961448401 3:126991725-126991747 GAGGGGAGTGGGGCCCTTCAAGG - Intronic
961637353 3:128341900-128341922 AAGGGGTGTGGGGCCAGGCAAGG - Intronic
962321805 3:134396700-134396722 CAGGGGAGAGGGGCCATCCATGG - Intergenic
963127291 3:141827561-141827583 GAGGGGTGAGGGGACCAGCGTGG - Intergenic
966674731 3:182572624-182572646 CAGGGGGTGGGGGCCCTGCAGGG - Intergenic
967690930 3:192472733-192472755 CAGGGCTGAGGAGCCCAGCAGGG - Intronic
967920136 3:194608348-194608370 CAGTGGTGAGGGCCCCTGCCAGG - Intronic
968689025 4:1980604-1980626 CAGGGGTGTGTGGCCCTGCAGGG + Exonic
968926626 4:3551772-3551794 TCTGGGTGAGGGGTCCTGCATGG - Intergenic
968936320 4:3612304-3612326 TAGGGGTGGGGGTCCCTGAGGGG + Intergenic
969564184 4:7967967-7967989 TAGGGGTTGCAGGCCCTGCAAGG - Intronic
971458977 4:26873790-26873812 AAGGGGTAAGGGGCTCTACAAGG + Intronic
974507589 4:62796955-62796977 TAGGGAGGAGGGACCCTGCATGG - Intergenic
975802594 4:78077072-78077094 TAGGTGTGAGGCACCATGCAAGG - Intronic
978429698 4:108620708-108620730 TAGGGGTAAGGGGCACAACAGGG + Exonic
985042751 4:185908042-185908064 TAGTGGTGAGGAGCTCAGCATGG - Intronic
985553939 5:547009-547031 GAGGGGTGAGGGTCCCTGCAGGG - Intergenic
985651973 5:1111665-1111687 AGGGGGCGAGGGGCCCTGCCAGG - Intronic
985843318 5:2325861-2325883 AAGGGCTGGGAGGCCCTGCATGG - Intergenic
985935868 5:3097436-3097458 GAGGGGTCCCGGGCCCTGCATGG - Intergenic
986005227 5:3661946-3661968 TAGGGGGGCGAGGCCCTACAGGG + Intergenic
986637289 5:9835737-9835759 TGTGGGAGAGGGGCCCAGCAGGG - Intergenic
990734095 5:58841111-58841133 CAGGGGGCAGGGGCACTGCAGGG + Intronic
992409718 5:76493340-76493362 TAGGGGTGAGAGGAACAGCAAGG - Intronic
997232340 5:132254061-132254083 CAGGGGTCAAGGGCTCTGCAAGG - Intronic
997399511 5:133591554-133591576 AGTGGGTGAGGGGCCCTCCAGGG - Intronic
997639818 5:135441847-135441869 ATGGGGTGTGGGGCCCTGCGTGG + Intergenic
997976445 5:138444309-138444331 TAAGAGTGAGGGGCTGTGCAGGG + Intronic
998529034 5:142868330-142868352 AAGGCCTGAGAGGCCCTGCAGGG - Intronic
999298452 5:150475302-150475324 TAGGTGTGAAGGGCCGTCCAGGG - Intergenic
1001575028 5:172757728-172757750 TAGTAGTGCCGGGCCCTGCATGG - Intergenic
1001689766 5:173624340-173624362 TAGAGGGGAGGGGCCATGCCGGG + Intergenic
1002621595 5:180492350-180492372 CAGGGAGGAGAGGCCCTGCAGGG + Intergenic
1002926616 6:1609177-1609199 AAGGGGTGCGGGGCCCTGCTGGG - Intergenic
1006007413 6:31013415-31013437 TGGGGGTGAGGGGCCAGGCCCGG - Intronic
1006116709 6:31779551-31779573 AGGGGGTGAGGGGGCCTGGAGGG + Intronic
1006119661 6:31796056-31796078 TAGCGGGGAGGTGCCCAGCAGGG + Intergenic
1006389999 6:33752609-33752631 AAGAGGTGAGAGGCCCTGCCTGG + Intergenic
1007610099 6:43143616-43143638 CAACGGTGAGGGGCCCTGGACGG + Exonic
1007654984 6:43446450-43446472 TAGGGGTGAGGGGTCCTGGGTGG - Intronic
1007725367 6:43912844-43912866 GAGGGTCGATGGGCCCTGCATGG - Intergenic
1007764333 6:44152083-44152105 TAGGGTTGAGGGGCACAGGAGGG + Intronic
1008543779 6:52568084-52568106 GAGAGGTGAAGGGCCTTGCATGG + Intronic
1011241078 6:85271951-85271973 AAGGGGTGAAGGGCCGGGCACGG - Intergenic
1014978472 6:127918524-127918546 TAGGGGTGAGAGGCTCTTCCTGG - Intronic
1017242207 6:152183104-152183126 GAGGGGTAAGGGGTCCTGGAAGG - Intronic
1017770203 6:157638799-157638821 TTGGGGTGGGGTGTCCTGCAGGG + Intronic
1018937557 6:168283620-168283642 CTGCGGTGAGGGGCCCTCCAGGG + Intergenic
1019737218 7:2656530-2656552 AAGAGGTGAGGGGCCCTGGGGGG + Exonic
1019861101 7:3658906-3658928 TAGTGGTGATGGGCCAGGCATGG - Intronic
1019872536 7:3778787-3778809 TAAGGTTGAAGGGCCCTGCAGGG + Intronic
1020079056 7:5276738-5276760 ATGGGGTGAAGGGCCCTGCTTGG - Intronic
1021813881 7:24428816-24428838 TAGGGAAGAGGTGCCTTGCAGGG - Intergenic
1022312383 7:29209181-29209203 AAGGGGTGAGGAGGCCTGAACGG + Intronic
1024764454 7:52640636-52640658 TTGGGCTGAGGGCACCTGCAAGG + Intergenic
1024803953 7:53114260-53114282 AAGGGGTAAGTGGACCTGCATGG + Intergenic
1024935262 7:54705703-54705725 TAGGGGAAAGGATCCCTGCATGG - Intergenic
1025199842 7:56955440-56955462 ATGGGGTGAAGGGCCCTGCTCGG + Intergenic
1026413327 7:70151158-70151180 TAGGGGGGAGGGGTGATGCACGG + Intronic
1026911453 7:74093904-74093926 GAGGGGTGAGGGGCGGGGCAGGG + Intronic
1027227691 7:76254783-76254805 TAGGGGTAATGGGCCCTGGAAGG + Intronic
1027262858 7:76477372-76477394 TAGGGGTGAGGGGCCAGGAGAGG + Intronic
1027314240 7:76975481-76975503 TAGGGGTGAGGGGCCAGGAGAGG + Intergenic
1028609798 7:92697987-92698009 TAGGAGTGAGGGGCCCAGACTGG - Intronic
1029370826 7:100149350-100149372 TAGGGGGGAGGGGGCCGGGAAGG + Intronic
1031482870 7:122299986-122300008 TTGGCGTGAGGGTCCCTGCGGGG + Intergenic
1032851794 7:135801669-135801691 TAGGGATGAGGGGCACGGCGGGG - Intergenic
1033121867 7:138673811-138673833 TAGGGGAGAGGGACCAGGCAGGG + Intronic
1034440424 7:151083186-151083208 TGGGGTTGAGGGGACCTGGAGGG - Intronic
1034903407 7:154922354-154922376 TAGGTGTGAGCCACCCTGCATGG - Intergenic
1035004245 7:155643834-155643856 TTGGGGTGTGGGGCCCGGGAAGG - Intronic
1035396458 7:158538349-158538371 CAGGGGTGAGGGGCAGTGCTGGG - Intronic
1035460806 7:159037351-159037373 TGGGTGGCAGGGGCCCTGCAGGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035595561 8:854692-854714 CAGGGGTGAGGGGACATGGAGGG + Intergenic
1036765706 8:11548153-11548175 TGGGGGAGGGGGGTCCTGCAGGG - Intronic
1037736085 8:21567329-21567351 TAGGGATGTGGGGAGCTGCAAGG + Intergenic
1038476983 8:27875440-27875462 TAGGGGTGAGGGAGCATGGAAGG + Intronic
1041345237 8:56890256-56890278 TATCGGTGAGGGGCCTTCCATGG + Intergenic
1049206742 8:141367106-141367128 TGGGGGTGAGAACCCCTGCAGGG + Intronic
1049554246 8:143274290-143274312 TACGGGTGTGGGAGCCTGCAGGG + Intronic
1049554600 8:143275682-143275704 CAGGGGTGGGGGGCGTTGCAGGG - Intronic
1049655284 8:143794476-143794498 TGGTGGTGAGGGGCCAGGCAGGG - Intronic
1053801545 9:41767154-41767176 TCTGGGTGAGGGGTCCTGCATGG - Intergenic
1054143654 9:61547672-61547694 TCTGGGTGAGGGGTCCTGCATGG + Intergenic
1054189976 9:61979308-61979330 TCTGGGTGAGGGGTCCTGCATGG - Intergenic
1054463430 9:65479007-65479029 TCTGGGTGAGGGGTCCTGCATGG + Intergenic
1054648538 9:67609283-67609305 TCTGGGTGAGGGGTCCTGCATGG + Intergenic
1055465691 9:76563644-76563666 TAGGGGTGAGGGTCCCAGAAGGG - Intergenic
1055513496 9:77016604-77016626 TCGAGGGGAGGGGCCCTTCAGGG - Intergenic
1056786546 9:89596747-89596769 AAGGGGTCTGGGGTCCTGCATGG - Intergenic
1056831114 9:89918224-89918246 TAGGAGTGTGGGGTCCAGCAAGG + Intergenic
1057171150 9:92963964-92963986 CAGGGAGGAGGGGCCCAGCAGGG - Intronic
1057868763 9:98702207-98702229 AAGGAGAGAGGGTCCCTGCAGGG - Intronic
1060154365 9:121308974-121308996 GTGGGCTGAGGGGCCCTGGATGG + Intronic
1060402153 9:123355506-123355528 CAGGGGTGAGGTGCCCTGCAGGG + Intergenic
1060728854 9:126024696-126024718 TGGGGAGGAGGGGCCCTGCCTGG + Intergenic
1061519905 9:131111860-131111882 GAGGGGTGACGGGGCCCGCAGGG - Intronic
1062129742 9:134885918-134885940 TGGGGGTCGGGGGCCCTGAATGG + Intronic
1062178666 9:135178910-135178932 AAGGAGTGAGGAGTCCTGCATGG + Intergenic
1062214563 9:135382237-135382259 AAGGGGAGAGGTGCCCTGCGGGG - Intergenic
1062255504 9:135618980-135619002 GAGGGGTGAGGGGCCCAGGCAGG - Intergenic
1062567756 9:137170822-137170844 GAGGGGTGTGAGGGCCTGCAGGG + Intronic
1062586117 9:137250847-137250869 TAGGAGGGAGGGGCCCAGGAAGG - Intergenic
1185652356 X:1657697-1657719 GAAGGGTGATGGGGCCTGCAGGG - Intergenic
1189316489 X:40060635-40060657 TAGGAATGAGTGGCCCTGCCTGG + Intronic
1189471932 X:41321582-41321604 GTGGGGTGTGGGGCCCTGGATGG - Intergenic
1191853881 X:65607320-65607342 TCTGGGTCAGAGGCCCTGCAGGG - Intronic
1192222672 X:69207953-69207975 GTGGGGTGAGGGGACCAGCAGGG + Intergenic
1192553162 X:72069814-72069836 CAAGGGTCAGGGGCCCCGCATGG - Intergenic
1198847631 X:140929740-140929762 TAGGGGCGAGGGGTGCAGCATGG - Intergenic
1199983179 X:152932282-152932304 AAGGGGTGAGGGGTCCAGGACGG + Intronic
1200138816 X:153887221-153887243 AAGTGGTGTGGGGCCCTGGAGGG + Intronic
1200243069 X:154507868-154507890 CAGGAGGGAGGGGCCCTGCTGGG + Intronic
1200247503 X:154533958-154533980 TAGGGAAGAGTAGCCCTGCAGGG + Intronic