ID: 1184841982

View in Genome Browser
Species Human (GRCh38)
Location 22:47057388-47057410
Sequence CCACCCTGGTTCCCTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184841982_1184841988 15 Left 1184841982 22:47057388-47057410 CCAGGTGCAGGGAACCAGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 324
Right 1184841988 22:47057426-47057448 ACAGTGCTACACTTTCTTTCCGG No data
1184841982_1184841989 16 Left 1184841982 22:47057388-47057410 CCAGGTGCAGGGAACCAGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 324
Right 1184841989 22:47057427-47057449 CAGTGCTACACTTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 14
4: 165
1184841982_1184841990 24 Left 1184841982 22:47057388-47057410 CCAGGTGCAGGGAACCAGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 324
Right 1184841990 22:47057435-47057457 CACTTTCTTTCCGGGAGCCGTGG No data
1184841982_1184841985 -8 Left 1184841982 22:47057388-47057410 CCAGGTGCAGGGAACCAGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 324
Right 1184841985 22:47057403-47057425 CAGGGTGGCTCGAACCCAGATGG 0: 1
1: 0
2: 2
3: 59
4: 1052
1184841982_1184841991 25 Left 1184841982 22:47057388-47057410 CCAGGTGCAGGGAACCAGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 324
Right 1184841991 22:47057436-47057458 ACTTTCTTTCCGGGAGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184841982 Original CRISPR CCACCCTGGTTCCCTGCACC TGG (reversed) Intronic
900984781 1:6066887-6066909 GCACCTTGCTTCCCTCCACCCGG + Intronic
901209219 1:7515077-7515099 CCTCCCCGGCTCCCTCCACCTGG + Intronic
901209232 1:7515115-7515137 CCTCCCCGGCTCCCTCCACCTGG + Intronic
901209245 1:7515153-7515175 CCTCCCCGGCTCCCTCCACCTGG + Intronic
901633044 1:10657091-10657113 CCAGCCAGGGTCTCTGCACCTGG - Intronic
901752033 1:11416260-11416282 CCACCCAGGTTCCCTCTTCCAGG + Intergenic
902549110 1:17208692-17208714 CCACCCTGATTCCCTGGATCTGG + Intronic
902633544 1:17720031-17720053 CCACACTCTTTCCCGGCACCAGG - Intergenic
902644423 1:17788594-17788616 CCACCCTCCTCCTCTGCACCTGG - Intronic
903744406 1:25576989-25577011 CGCCCCAGGCTCCCTGCACCGGG - Intergenic
905258722 1:36702587-36702609 GCACCCTGGTTCCCTGACGCTGG + Intergenic
905888084 1:41502392-41502414 CCACTCTGGCACCCTGAACCTGG + Intergenic
906061000 1:42948479-42948501 GTCCCCTGCTTCCCTGCACCTGG - Intronic
906154568 1:43606485-43606507 GCACCCTGATTCCCTGGGCCTGG + Intronic
906322828 1:44827430-44827452 CCACCCAGGCACCCCGCACCTGG - Exonic
908195373 1:61742396-61742418 CCACCCCGGTGCCCCGCCCCGGG + Intergenic
908450253 1:64247492-64247514 CCACCCTCCTTCCCTGCCCAAGG - Intronic
909629893 1:77759944-77759966 CCGGCCTGGGTCCCCGCACCTGG - Intergenic
911165801 1:94723540-94723562 CCACCCTGGCTCCAGGCCCCAGG - Intergenic
913686723 1:121239076-121239098 CCCCCTAGGTTCCCAGCACCTGG - Intronic
914038577 1:144026719-144026741 CCCCCTAGGTTCCCAGCACCTGG - Intergenic
914150878 1:145041188-145041210 CCCCCTAGGTTCCCAGCACCTGG + Intronic
915596879 1:156901143-156901165 CCACCCTGGCTTCCAGCCCCTGG + Intronic
916922521 1:169484436-169484458 CCACCCTGCCTCCTTGCCCCAGG - Intronic
917966434 1:180182116-180182138 CAGCCCTGGCTCCCTCCACCCGG + Intronic
919613180 1:199772254-199772276 CCACCCAGATTCCCTTTACCAGG - Intergenic
919865679 1:201781218-201781240 CCACCCTGGTTCCCTGAAGAAGG + Exonic
920474048 1:206257632-206257654 CCCCCTAGGTTCCCAGCACCTGG - Intronic
920678356 1:208054379-208054401 CCTCCCTGGGCACCTGCACCTGG + Intronic
920834870 1:209501760-209501782 CCACTCTGGACACCTGCACCTGG - Intergenic
920834967 1:209502314-209502336 ACACCCTGCTTCCCTGGAGCTGG - Intergenic
921736590 1:218634864-218634886 CCCACCTACTTCCCTGCACCTGG - Intergenic
922560893 1:226568831-226568853 CCACCCTCATTCCTGGCACCAGG - Intronic
923786058 1:237070657-237070679 CAACCCTGGCCTCCTGCACCTGG - Intronic
923964257 1:239119197-239119219 CCATCCTGGTTCCTTGCAGATGG + Intergenic
924193434 1:241579547-241579569 CCACCCAGCTTCCATGCACTTGG + Intronic
924712746 1:246544094-246544116 CCACCCTGGTTCCCTTGCTCTGG - Intronic
1062760261 10:12088-12110 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1063326005 10:5102889-5102911 CTACTCTGCATCCCTGCACCAGG + Intronic
1064042730 10:11982406-11982428 CCTCCCAGCTTGCCTGCACCAGG + Intronic
1064986287 10:21213627-21213649 CTGCCCTGGTTCCCTGCCTCGGG - Intergenic
1067216520 10:44308759-44308781 CCACTCTGCTTCCCTGTCCCAGG - Intergenic
1067809872 10:49418145-49418167 CCAGCCTGGTCCTCTGCTCCTGG - Intergenic
1067973107 10:50993189-50993211 CCACTCTGGCTCCCAGCTCCTGG - Intronic
1068213345 10:53951827-53951849 CCACCTTGCTGCTCTGCACCTGG - Intronic
1069873329 10:71546509-71546531 CCTCCCTAATTCCCTGAACCTGG - Intronic
1070046833 10:72846782-72846804 CTATCCTGGTTCCCTCCATCTGG - Intronic
1070527956 10:77311395-77311417 CCTCCCTGCTTCTCGGCACCAGG + Intronic
1070714581 10:78710037-78710059 CCACCCTGACTCCCTGCAACAGG - Intergenic
1070750709 10:78962499-78962521 CGACCCTGCTCCCCTGCAGCAGG - Intergenic
1070752005 10:78969379-78969401 CCACCCTGGGTCCATGCCTCAGG + Intergenic
1072611510 10:97020291-97020313 TCACCCAGGTAACCTGCACCTGG - Intronic
1073470212 10:103717471-103717493 GCCCCATGGTTCCCTCCACCAGG - Intronic
1073480593 10:103784027-103784049 CCACCCTGGTGCCCAGCTGCAGG + Intronic
1073567971 10:104551806-104551828 GCACCATGTTTCGCTGCACCTGG + Intergenic
1074039716 10:109776258-109776280 CCACCCAGATTCCCTCGACCAGG - Intergenic
1074559602 10:114523330-114523352 CCTACCTGGTTCTCTGAACCAGG - Intronic
1075092479 10:119451437-119451459 GCACCCTGGGTCCCCACACCTGG + Intronic
1075475769 10:122732170-122732192 GCACAGAGGTTCCCTGCACCTGG - Intergenic
1075568145 10:123519631-123519653 ACTCCCTGGTTCCCCGCAGCAGG - Intergenic
1076736618 10:132461974-132461996 CCAGCCTGCAGCCCTGCACCCGG + Intergenic
1077270718 11:1678323-1678345 CCTCCCTGGTCCCCAGCCCCAGG - Intergenic
1077310670 11:1887664-1887686 CCACCCTTGTAGCCTGCAACAGG - Intronic
1077401925 11:2363154-2363176 CCACCCCGGTTCCTTCCCCCAGG + Intergenic
1077560134 11:3255188-3255210 CCACACTTGTGCTCTGCACCCGG - Intergenic
1077566027 11:3300991-3301013 CCACACTTGTGCTCTGCACCCGG - Intergenic
1079073361 11:17367518-17367540 CCAGCCTAGGTCCCTACACCTGG + Intronic
1079088641 11:17465067-17465089 CCACCTTGGGTCCCTGCAGGAGG + Intronic
1079124584 11:17709579-17709601 CCACCCTGTTTCCAGGCCCCAGG - Intergenic
1080029259 11:27643701-27643723 CCATCCTGCATCCCTGCATCAGG - Intergenic
1080120211 11:28668163-28668185 GCATCCTGGTTCCCTGCCTCTGG + Intergenic
1080935304 11:36857068-36857090 TGACCCTGGTTCCCTGCTCTAGG + Intergenic
1083366012 11:62141804-62141826 CCTCCCTCCTCCCCTGCACCAGG + Intronic
1083602937 11:63960226-63960248 CCACCCTTGTCCCCAGCACCAGG - Intergenic
1083609023 11:63996386-63996408 CCACCCTGGGTCCCTGAAACAGG - Intronic
1083618331 11:64036921-64036943 CAACCACGGTTCCCTGCAGCTGG - Intronic
1083619224 11:64040752-64040774 CCAGCCCACTTCCCTGCACCGGG - Intronic
1083667453 11:64283646-64283668 CCTCCTTGGTGCCCTGCCCCAGG - Intronic
1083678084 11:64338902-64338924 CAAGCCTGGTTCCCTTCCCCTGG + Intergenic
1084594681 11:70109849-70109871 CGGGGCTGGTTCCCTGCACCTGG + Intronic
1084673773 11:70622583-70622605 CCACCCTGGTGCCCTCCCCTTGG + Intronic
1084770367 11:71339114-71339136 ACACCCTGGTTGCCTCCTCCAGG + Intergenic
1085515903 11:77111921-77111943 CCACCCCTGCTCCCTGCTCCAGG - Intronic
1086566338 11:88231057-88231079 CCACCCTGGGTCCCAGGCCCAGG - Intergenic
1088073794 11:105821976-105821998 CCACGCAGGTTCCCAGAACCGGG + Intronic
1088586111 11:111361292-111361314 CCAGCCTGGTTCTGTGCCCCGGG + Intronic
1089370860 11:117955847-117955869 ACACTCTGGTTCCCTACAGCTGG - Intergenic
1091227903 11:133968765-133968787 CCACTCTGGCTCCCAGCCCCAGG + Intergenic
1091280761 11:134380330-134380352 CCTCCCTGGCTCCCTGTCCCTGG - Intronic
1091360253 11:134973753-134973775 CCATCCTGGCTCCCAGCAGCTGG - Intergenic
1091750532 12:3019048-3019070 CCGCCCCGGATCCCTGCACTGGG - Intronic
1092182171 12:6453326-6453348 CCTCCCGGGCTCCCTCCACCAGG + Intronic
1093599362 12:21002741-21002763 CCACCCTGCTTCCAGGCACTTGG + Intergenic
1095968843 12:47887623-47887645 CCACCTTTGTGGCCTGCACCTGG + Intronic
1096001140 12:48131560-48131582 CCACCCTGGTTTCCTGGGGCAGG + Intronic
1096116980 12:49060486-49060508 CAACCCCGGCTCCCGGCACCGGG + Intergenic
1097263320 12:57731838-57731860 CACCCCAGGGTCCCTGCACCGGG - Exonic
1100103399 12:91138449-91138471 CCACCCAGGCTGCCTGCACCAGG + Intergenic
1100667414 12:96769983-96770005 CGACCCTGTATCTCTGCACCAGG - Intronic
1101717254 12:107321407-107321429 CCGCCCTCGGTCCCTTCACCTGG + Intronic
1102257446 12:111424534-111424556 CCTCCCTGGTTCCCTGGATTGGG - Intronic
1102806762 12:115788402-115788424 CCACCCAGGATACCTGCCCCAGG - Intergenic
1103122478 12:118392328-118392350 CCAAGCTGGTTCACAGCACCAGG - Intronic
1105416568 13:20218423-20218445 CCACCATGTTGCCCTGCCCCAGG - Intergenic
1106108400 13:26755620-26755642 CCACCCTGCTTCCCTGCCCCAGG + Exonic
1108624296 13:52211988-52212010 CCACCCTGGCTCTCTGGACATGG + Intergenic
1111726823 13:92021465-92021487 CCTTCCCAGTTCCCTGCACCTGG - Intronic
1112460541 13:99600208-99600230 CCACCCAGGTGCCAGGCACCAGG + Intergenic
1112671730 13:101647620-101647642 TCACCCTCTTTCCCTGCACAGGG - Intronic
1113385604 13:109845030-109845052 CCAGCCTGGGCCTCTGCACCGGG - Intergenic
1113484229 13:110642627-110642649 CTTCCCTGATTCCCTGCAGCTGG + Intronic
1113833290 13:113313593-113313615 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833316 13:113313689-113313711 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833341 13:113313785-113313807 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833366 13:113313881-113313903 CCACGCTGGTTCCCTCCAGGAGG - Intronic
1113833392 13:113313977-113313999 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833418 13:113314073-113314095 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833499 13:113314361-113314383 CCACGCTGGTTCCCTCCAGGAGG - Intronic
1113833525 13:113314457-113314479 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833550 13:113314553-113314575 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833575 13:113314649-113314671 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833600 13:113314745-113314767 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833649 13:113314937-113314959 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833674 13:113315032-113315054 CCACACTGGTTCCCTCCAGGAGG - Intronic
1113833740 13:113315272-113315294 CCACGCTGGTTCCCTCCAGGAGG - Intronic
1114031597 14:18584492-18584514 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1118216809 14:63816526-63816548 CCACCCTTCTTCCCTGAAGCAGG + Intergenic
1118258520 14:64225709-64225731 CCACACAGGTTCCCTGCTCCTGG - Exonic
1118467732 14:66045985-66046007 CCACGCTGGTTCCAAGCACACGG + Intergenic
1120654325 14:87170563-87170585 CAACCCTGGTTCCCAGAACAGGG - Intergenic
1121428760 14:93872471-93872493 TCACCTTGGTCCCCAGCACCTGG + Intergenic
1121571653 14:94951051-94951073 CCACCCAGGAGCCCTGCATCTGG - Intergenic
1121931563 14:97977105-97977127 CCACCCTGGTGGCCTGCCCTGGG + Intronic
1122297670 14:100714385-100714407 CCACCCTGTCTCCCTCCACATGG - Intergenic
1122631587 14:103109731-103109753 CCAGCCTGGGTCTCTCCACCCGG + Intronic
1123016820 14:105379717-105379739 CCACCCCTGTTCCCTGAGCCAGG + Exonic
1123931285 15:25172888-25172910 CCACCCACGTGCCCTGCTCCAGG - Intergenic
1123940392 15:25213900-25213922 GCACTCTGGTTCCCTGGGCCAGG + Intergenic
1123990317 15:25678540-25678562 CCACCATGGCACCCTGCACCAGG - Exonic
1124389847 15:29244595-29244617 CCACGCTGCTTCCCTGATCCAGG - Intronic
1124967655 15:34448443-34448465 CCGCCCTGCCTCCCTCCACCCGG - Intergenic
1125720717 15:41843926-41843948 CCACCCTGCTTCCTCTCACCTGG + Intronic
1126684846 15:51239859-51239881 CCCCCCTAGTTCCCTGCTCTGGG + Intronic
1128896400 15:71377502-71377524 GCCCCCTGGTTCCCTTCCCCTGG - Intronic
1129139684 15:73586145-73586167 CCACCCTGCCTCTCTGCACTTGG + Intronic
1129191675 15:73941308-73941330 TCACCCTGGCTGCCTGGACCAGG + Intronic
1129328263 15:74813244-74813266 CCTCTCTGCTTCCCTGCCCCAGG + Intronic
1129467258 15:75731105-75731127 CCACTCAGGTTCCCAGGACCTGG + Intergenic
1129603371 15:77012950-77012972 CCCCACTGGATCCCGGCACCTGG - Intronic
1129719968 15:77872612-77872634 CCACTCTGGTTCCCAGGACCTGG - Intergenic
1130995573 15:88901983-88902005 CCACCCTTCTCCTCTGCACCAGG + Intronic
1132057142 15:98660941-98660963 CCACCCTGGCCCTCTGCACCAGG - Intronic
1132237357 15:100232275-100232297 CCACCCTGGCTCCATGCTGCAGG - Intronic
1132296293 15:100737143-100737165 CTACCCAGGTTCCCAGCTCCCGG - Intergenic
1133224194 16:4332834-4332856 CCACCCTGGGCCCAAGCACCGGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134309501 16:13062881-13062903 TCACCCTGGTACCCTGATCCTGG + Intronic
1135585844 16:23670187-23670209 TCACCTTTGTTCCCTGCAGCAGG - Exonic
1136287544 16:29253334-29253356 ACACCCTGGCTCCCTGCACATGG + Intergenic
1137625328 16:49904085-49904107 CCACCCACGGTCCCTGTACCTGG + Intergenic
1137769957 16:51008214-51008236 CCACCATTGTCCCCTGGACCAGG + Intergenic
1138520065 16:57565987-57566009 CCACTATGGTTCCCTCCACCTGG + Intronic
1139937615 16:70582743-70582765 TCTCCCTGCTTCCCAGCACCAGG - Intronic
1139947237 16:70649709-70649731 CCTTCCTGGTTCCCTGGCCCTGG - Intronic
1140043707 16:71425938-71425960 CCACCCTGGAACCCTGCATTTGG + Intergenic
1141667422 16:85473056-85473078 CCTCCCTTGTGCCCTGCTCCTGG - Intergenic
1141814331 16:86399577-86399599 CCCCCCTGGTTCCCTCCAAGGGG + Intergenic
1142093165 16:88225963-88225985 ACACCCTGGCTCCTTGCACATGG + Intergenic
1142167457 16:88600015-88600037 GCACCCTGGGGCCCTGCACATGG - Intronic
1142195655 16:88738172-88738194 CCACCCTGGTCCCGCCCACCTGG - Intronic
1142466663 17:140855-140877 CCACCCATGTTCCCCTCACCAGG - Intergenic
1142466798 17:141185-141207 CCACCCATGTTCCCCTCACCAGG - Intergenic
1142466937 17:141534-141556 CCACCCATGTTCCCCTCACCAGG - Intergenic
1143517614 17:7427609-7427631 CCAGCCTGGGTCCCTGCCCTTGG + Intergenic
1143728426 17:8865899-8865921 CCACCAAGCTTCCCTGCCCCTGG - Intronic
1145813201 17:27777219-27777241 CCAGCCTAGTGCCCAGCACCAGG + Intronic
1146314516 17:31796659-31796681 CAACCCTGGTCGCTTGCACCTGG + Intergenic
1147789354 17:43003702-43003724 CCACCCTGGAGACCTGCTCCTGG + Intergenic
1147860772 17:43521503-43521525 CCAGGCTCGTTCCCTGCGCCGGG + Exonic
1148015299 17:44517641-44517663 CCAGCCTGGTTCCTCACACCTGG - Intergenic
1150636078 17:66914238-66914260 CCAGCATGCTTCCCTGCCCCAGG + Intergenic
1151680731 17:75621390-75621412 CCACCTTGGTGTACTGCACCAGG - Intergenic
1152953169 18:12442-12464 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1154284500 18:13039544-13039566 CCACCCTGGTTCCTACCTCCAGG - Intronic
1156383744 18:36587323-36587345 CCACCCTGGATCCCAGCAGTCGG + Intronic
1157619558 18:49008491-49008513 CCACCTGGGTCCCCTGCAGCAGG + Intergenic
1158310479 18:56152520-56152542 CCACCCTGATTCCCTTCCCTGGG + Intergenic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1160509527 18:79445424-79445446 CCTGCCTGGTTCCCTGGCCCCGG + Intronic
1160722857 19:604901-604923 CCACCCTGCAGCCCTGCCCCGGG - Intronic
1160977885 19:1802691-1802713 CTCCCCAGGTTCCCTGCACCGGG + Intronic
1161484760 19:4529309-4529331 CCACCCTAGTTCCCTGGGGCTGG + Exonic
1161600982 19:5182560-5182582 CCACCCAGGTACCCTTCAACAGG - Intronic
1162533377 19:11248633-11248655 CCACCATGGCTCCTTACACCAGG - Intronic
1163127049 19:15249996-15250018 CCAACATGGCTCCCTGGACCAGG + Intronic
1163433618 19:17282521-17282543 CCACCCTGGTACACTGCCCTTGG - Intronic
1164725564 19:30463567-30463589 CCATCATGCTTCCCTGCACGGGG + Intronic
1165060014 19:33200619-33200641 CCAGCCTGGTTCCCTTTGCCGGG - Intronic
1165112845 19:33512380-33512402 CCAGGCTGGTTTCCTGCAGCTGG + Intronic
1165176138 19:33931211-33931233 CCCACCTGGTGCCCTGTACCTGG - Intergenic
1165800045 19:38543763-38543785 CCTCCCAGGGTCCCTGCACCGGG + Exonic
1166054586 19:40280718-40280740 GCACTGTGGTTCCCTCCACCTGG + Intronic
1166874708 19:45890515-45890537 GCACCCTAGCTCCCTGCTCCAGG - Exonic
1167265158 19:48479442-48479464 CCAGCCTGTTTCCCTGGACAGGG + Intronic
927971344 2:27307750-27307772 CCACCCTGGTTCCGTGCCCCGGG + Exonic
928480279 2:31676018-31676040 CCACCCTGCTCCCATGCACTTGG + Intergenic
932493724 2:72136536-72136558 CCTCCCTCCTTCCCTCCACCGGG - Intronic
935697422 2:105782233-105782255 CCACCCTGAGTCCCTGGGCCCGG - Intronic
937136822 2:119560453-119560475 CCACCCCCATCCCCTGCACCAGG - Intronic
938070609 2:128306373-128306395 ACAGCCTGGCTCCCTGCTCCAGG + Intronic
938791680 2:134681713-134681735 TGACCCTGGTTCCCAGCACATGG + Intronic
943355727 2:186852797-186852819 CCATGGTGGTTTCCTGCACCTGG - Intergenic
944187357 2:196964037-196964059 CCACCTTGGCTCCCTGACCCTGG + Intergenic
946326193 2:218985688-218985710 CCACCCGGGTTCCCGTCTCCAGG + Intergenic
946405188 2:219488671-219488693 CCCCCCTGGGGCCCTGCCCCAGG - Intronic
947743288 2:232494721-232494743 CCACCCAGGCTTCCTGCTCCGGG - Intergenic
1168973589 20:1947545-1947567 CCGTCCCGGTTCCCTGCGCCAGG - Intergenic
1169687211 20:8288730-8288752 CCACTCAGGTTCCCTTCACGGGG - Intronic
1171018295 20:21561573-21561595 CCACCCTGGTCTCCTTCACAAGG - Intergenic
1171196065 20:23200627-23200649 CCACCCTGTTGCCCTGCACGCGG - Intergenic
1171902185 20:30868311-30868333 CCGCCATGCATCCCTGCACCAGG + Intergenic
1172056835 20:32159935-32159957 CCACCCTGCTCCCCTTCCCCTGG - Intronic
1173659635 20:44724544-44724566 GCACCCTGGATCCCGGCACAGGG - Intronic
1174180558 20:48671851-48671873 CCACCCTGTGTCCCCACACCAGG + Intronic
1174426625 20:50436198-50436220 CCACACGTGTTGCCTGCACCCGG - Intergenic
1175221933 20:57422199-57422221 CCTCCCCTGTTCCCTGCTCCTGG + Intergenic
1176056370 20:63151224-63151246 GCACCCTGGTGCCCAGCACTTGG + Intergenic
1176090881 20:63318177-63318199 CCACCCTGGGTGGCCGCACCTGG - Intronic
1179822234 21:43943634-43943656 GCACCTCGGTTCCCTGCGCCTGG + Intronic
1179963556 21:44786140-44786162 CCACTCTGGGCCCCTGCAGCAGG + Intronic
1180054272 21:45349105-45349127 CCACCCTGGATCCATGCACCGGG - Intergenic
1180455709 22:15511549-15511571 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1181330675 22:22088200-22088222 CCAGCCAGGATCACTGCACCAGG - Intergenic
1181588545 22:23868288-23868310 CCAGCATGGTGCCCTGCACAAGG + Intronic
1181712557 22:24699762-24699784 TCACCCTGGGCCCCTGAACCAGG + Intergenic
1182085617 22:27559230-27559252 CCACCCAGGTGCCCTTCAACAGG + Intergenic
1182230739 22:28835845-28835867 CAACCCTGCTTCCCTGGGCCAGG - Intergenic
1182254945 22:29031358-29031380 CCACCCCCGTTCCTGGCACCAGG + Intronic
1182328071 22:29529382-29529404 CCACCTTGTTTCCCTTCATCTGG - Intronic
1183587494 22:38761242-38761264 CCACCCAGACTCCCTACACCTGG - Intronic
1183966501 22:41445937-41445959 CCACCCCCCTTCCCTGCACACGG + Intronic
1184554754 22:45227111-45227133 CCACCCTTGTGCCCAGCACCCGG + Intronic
1184841982 22:47057388-47057410 CCACCCTGGTTCCCTGCACCTGG - Intronic
1185098848 22:48826751-48826773 CCACCTGGCTTCCCAGCACCTGG + Intronic
1185153420 22:49179394-49179416 CCACCCTGGCTCCCTGCCTGTGG + Intergenic
1185157731 22:49204397-49204419 CCCACCTGCTTCCCTTCACCGGG + Intergenic
1185381004 22:50507563-50507585 CCACCCTGGGTGCCTTCACCTGG + Exonic
950457214 3:13099904-13099926 CCACCCTGATTCCTTGTTCCTGG - Intergenic
950577724 3:13842797-13842819 CCATCCTGCCTCCCTGCTCCAGG - Intronic
951207285 3:19938110-19938132 CCACCTAGGTTCCCTTCACCTGG + Intronic
952342271 3:32456451-32456473 CCACCATGGGTCCCAGCGCCCGG - Intronic
952900491 3:38108909-38108931 CCACCCTGGTGGCCTCCAGCGGG - Intronic
953431598 3:42844853-42844875 GCACCATGCTCCCCTGCACCTGG - Intronic
953551186 3:43904594-43904616 CCACACTGATTCACTGCCCCAGG - Intergenic
953757227 3:45657131-45657153 CCTCCCTGCTTCTCAGCACCAGG + Intronic
953805768 3:46066066-46066088 CTACCCTCGCTCCCTCCACCAGG - Intergenic
953905756 3:46867574-46867596 CGACCCTGTTTCCCTGCCTCTGG - Intronic
953961996 3:47273551-47273573 CCTCCCTCGTGCCCTGCAGCAGG - Exonic
954462987 3:50638264-50638286 CCATCCTCCCTCCCTGCACCGGG - Intronic
955350847 3:58191934-58191956 CCACCCTGAACCCCTGCTCCAGG - Intergenic
957244148 3:77696808-77696830 ACACCCTGGCCCTCTGCACCAGG + Intergenic
960692570 3:120362154-120362176 CCATCCTGGGTCCCAGCAGCAGG + Intergenic
961164150 3:124751904-124751926 CCACCCTGCCACCCTGCCCCTGG + Intergenic
969438102 4:7200052-7200074 CCACGCTGCTGCCCTGCACGCGG - Intronic
969484660 4:7465459-7465481 CCACCCTGGCGCCTTGCACAGGG - Intronic
969517704 4:7656751-7656773 CCACCCCCATGCCCTGCACCAGG - Intronic
972029109 4:34429845-34429867 CCACCATCGTTCCCTGCGGCAGG + Intergenic
973687828 4:53391457-53391479 CCATCTTGGATCTCTGCACCTGG - Exonic
974875506 4:67699160-67699182 CCAGACTGGTTCCCTGTACCTGG - Intronic
979005193 4:115285690-115285712 CCACTCTAGTACCCTGCTCCAGG - Intergenic
980352734 4:131701842-131701864 CCACCCTGAGTCCCTCCCCCTGG - Intergenic
980756936 4:137177154-137177176 CCATCCTGGTACCCTGACCCAGG - Intergenic
980889948 4:138804227-138804249 CTACCCTGGTACCCTGAGCCAGG + Intergenic
981937179 4:150250515-150250537 CCACCCCTGTTCCCTGCTCCTGG - Intronic
985733657 5:1565240-1565262 GCATCCTGCCTCCCTGCACCTGG + Intergenic
986340947 5:6788770-6788792 CCACCCTGGATGCCGGCAGCAGG - Intergenic
986723255 5:10575655-10575677 CCACTCTGCTTCCCTTCACAGGG + Intronic
986915445 5:12613750-12613772 CCACCCAGTTTCCCTGGATCTGG + Intergenic
989217316 5:38918469-38918491 CCACCCTGGGACCCTGCAGGAGG - Intronic
990129423 5:52562582-52562604 CCAATATGGTTCCTTGCACCTGG - Intergenic
990368790 5:55095895-55095917 CCACCCTGCCCCACTGCACCAGG + Intergenic
992874523 5:81040599-81040621 CCAACTTGGTGCCCTGCACAGGG + Intronic
992897283 5:81255961-81255983 CCACCCTGGTTTCCTGCTTAAGG + Intronic
998129381 5:139643600-139643622 CCAATCTGGAGCCCTGCACCTGG - Intergenic
999206147 5:149849524-149849546 CCACTCAGGTTCCCTGAGCCTGG + Exonic
999935706 5:156483669-156483691 CTACCCTGGTGCCTTGCACATGG + Intronic
1001125210 5:169013118-169013140 TCTCCCTTGTCCCCTGCACCTGG - Intronic
1001310059 5:170604095-170604117 CTTCCCTGGTTCCCACCACCGGG - Intronic
1001314003 5:170629999-170630021 CCATCCCGTCTCCCTGCACCAGG + Intronic
1001811574 5:174632614-174632636 CCATCCTGGATGCCTGCATCTGG + Intergenic
1001953162 5:175830207-175830229 CTGCCCTGGTTCCCTGCCCCCGG + Intronic
1002311871 5:178319898-178319920 GCCCACTGCTTCCCTGCACCCGG + Intronic
1002641605 5:180633119-180633141 CCACCCTGGGACGCAGCACCAGG + Intronic
1003309339 6:4955705-4955727 CCTCCCTGGTCACCTTCACCCGG + Intergenic
1007746840 6:44048219-44048241 CCCCCCTGGGTTCCTGCCCCAGG - Intergenic
1011206020 6:84899026-84899048 CCACCCATCTTCCCTCCACCAGG + Intergenic
1012256311 6:97036773-97036795 CCACTCTGGCACCCTGCACCCGG - Intronic
1014594577 6:123318470-123318492 CCAACCTATTTCCCTTCACCCGG + Intronic
1016498427 6:144690345-144690367 CCACCTAGCTTCCCTGCACTTGG + Intronic
1016916281 6:149247207-149247229 CATCCCTGGTGCCCTGCACTGGG + Intronic
1017459682 6:154637301-154637323 ACAGCCTGGTTCCCTGTCCCTGG - Intergenic
1019703244 7:2484752-2484774 ACACCCTGGGGCCCAGCACCCGG + Intergenic
1020281773 7:6653519-6653541 CCAGCCCGGTACCCTCCACCAGG - Exonic
1024660358 7:51487161-51487183 CCAGCCTGGATCCCTGCTGCCGG + Intergenic
1024855051 7:53769452-53769474 CCCCCCTGCTTCCCTGATCCAGG + Intergenic
1025202490 7:56970827-56970849 CCACCGTGGTTCCCTGCTTGGGG - Intergenic
1025605761 7:63038892-63038914 CCACCCTGTTTCCCAGCGCATGG - Intergenic
1025669459 7:63606100-63606122 CCACCGTGGTTCCCTGCTTGGGG + Intergenic
1026466810 7:70661424-70661446 CCACCCTGGTCACCTGCCACAGG - Intronic
1026804000 7:73418252-73418274 CCTTCCTTCTTCCCTGCACCTGG - Intergenic
1029110602 7:98211504-98211526 CCACCCGAGTTCCCAGCTCCCGG - Intronic
1030114758 7:106054768-106054790 CCTCCCGGGTCCCATGCACCTGG + Intergenic
1033724952 7:144105739-144105761 CTACCCTGGGTCCCTGAACTGGG + Intergenic
1034174814 7:149091455-149091477 CCACCCTGAGTCCCTGCAGGCGG - Intergenic
1034450250 7:151133427-151133449 CCACCCTCCCTCCCTGCACTCGG + Intronic
1034911441 7:155002278-155002300 CCAGCCTGTGTCCCTGCACGTGG - Intronic
1034993397 7:155562275-155562297 CCACCCGGGTGCCCGGCTCCTGG - Intergenic
1035159292 7:156939368-156939390 CCACCCTGGGGCCCTGCGCCAGG + Intergenic
1035182041 7:157096591-157096613 CCACCAGGGTTCCCTGCTCCTGG - Intergenic
1035265974 7:157690539-157690561 CACCCCTGGTTACCTGCAGCTGG + Intronic
1035468110 7:159092872-159092894 CCACGCTGCTGCCCAGCACCAGG - Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1037381016 8:18285151-18285173 CCACCATGATTCTCTGCACTTGG + Intergenic
1037689559 8:21170726-21170748 CCAGGCTGGTTCCCTGTTCCGGG - Intergenic
1039228697 8:35419446-35419468 CCACCCTGGGTGCCAGCATCTGG + Intronic
1039989360 8:42474994-42475016 TCATCCTGGTTCCCCTCACCCGG - Intronic
1040356659 8:46624962-46624984 CCTCCCTGGTTCCATGCATTGGG + Intergenic
1042704381 8:71650895-71650917 GCACCCTTGACCCCTGCACCTGG + Intergenic
1045374598 8:101558584-101558606 CCACCGTGATTCCCGACACCGGG - Exonic
1047695591 8:127400714-127400736 CCAGCCTCGTTCTCTGCATCTGG + Intergenic
1048577090 8:135701414-135701436 GCACCCTGCTTCCCTGGAGCTGG - Intergenic
1049291713 8:141806838-141806860 CCACCTCGTTTCCCTGCTCCTGG - Intergenic
1050374685 9:4958450-4958472 CCACCCTGAGCACCTGCACCTGG + Intergenic
1050608806 9:7329992-7330014 CCACCATAGTTCACTGCACAAGG + Intergenic
1053381778 9:37654978-37655000 CCTCCCTCCTTCCCTGCCCCCGG + Intronic
1053779981 9:41597869-41597891 CCACCCTGAGTCCCTCCCCCTGG + Intergenic
1054167938 9:61808112-61808134 CCACCCTGAGTCCCTCCCCCTGG + Intergenic
1054669608 9:67772792-67772814 CCACCCTGAGTCCCTCCCCCTGG - Intergenic
1059347165 9:113636909-113636931 CCTCACTGGTTCTCTGCACTTGG + Intergenic
1060189933 9:121585982-121586004 CCACCCTGGCTCCCTGTCGCTGG + Intronic
1060754962 9:126205985-126206007 CCACCCTGGCACCCTGGCCCGGG + Intergenic
1061151299 9:128829703-128829725 CCACCATGCTGCCCTGCACGGGG + Intronic
1061219103 9:129238593-129238615 CCAGCCTGAGTCACTGCACCCGG + Intergenic
1061231022 9:129315868-129315890 CCACCCTGGCCTCCTGCACCGGG - Intergenic
1062227362 9:135460278-135460300 CCCACCTGTCTCCCTGCACCTGG - Intergenic
1062381478 9:136288840-136288862 CCGCCCTGGTTCCCATCCCCCGG - Intronic
1189056083 X:37700724-37700746 CCACCCTAGGTCCCAGCATCAGG - Intronic
1195094926 X:101493348-101493370 CCAGTCTGGTCCCCAGCACCAGG - Exonic
1196569331 X:117247418-117247440 TCAACCTGCTTCCCTACACCTGG + Intergenic
1199998355 X:153041694-153041716 TCAGCCTCCTTCCCTGCACCTGG + Intergenic
1200212236 X:154351865-154351887 CCAGCCGGGTTCCCAGTACCTGG + Exonic
1200216935 X:154372075-154372097 CCTCTCTGCTTCCCTCCACCCGG + Intronic
1200247585 X:154534304-154534326 CCACCCTGGTCCCCCGGCCCAGG + Intronic
1200543817 Y:4494166-4494188 CCACCCTAGCTGCCTGCCCCAGG - Intergenic