ID: 1184843113

View in Genome Browser
Species Human (GRCh38)
Location 22:47064042-47064064
Sequence CTGGAGATGCAGTTCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184843113_1184843115 -8 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843115 22:47064057-47064079 ATCTCCAGATGCCGTTTTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 195
1184843113_1184843118 -4 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843118 22:47064061-47064083 CCAGATGCCGTTTTCCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 131
1184843113_1184843125 25 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843125 22:47064090-47064112 TCACAGGAACCACCAGGACCGGG 0: 1
1: 0
2: 0
3: 24
4: 326
1184843113_1184843120 9 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843120 22:47064074-47064096 TCCAGGGAGGCCACGTTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 149
1184843113_1184843124 24 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843124 22:47064089-47064111 TTCACAGGAACCACCAGGACCGG 0: 1
1: 0
2: 2
3: 17
4: 170
1184843113_1184843116 -7 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843116 22:47064058-47064080 TCTCCAGATGCCGTTTTCCAGGG No data
1184843113_1184843123 19 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843123 22:47064084-47064106 CCACGTTCACAGGAACCACCAGG 0: 1
1: 0
2: 2
3: 6
4: 133
1184843113_1184843126 26 Left 1184843113 22:47064042-47064064 CCTCCTCTGAACTGCATCTCCAG No data
Right 1184843126 22:47064091-47064113 CACAGGAACCACCAGGACCGGGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184843113 Original CRISPR CTGGAGATGCAGTTCAGAGG AGG (reversed) Intronic
No off target data available for this crispr