ID: 1184846259

View in Genome Browser
Species Human (GRCh38)
Location 22:47089604-47089626
Sequence GTCACTCTAGTCACCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184846245_1184846259 29 Left 1184846245 22:47089552-47089574 CCTGGCCTGGGTGAGCTCGTGTG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1184846259 22:47089604-47089626 GTCACTCTAGTCACCAGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 112
1184846248_1184846259 24 Left 1184846248 22:47089557-47089579 CCTGGGTGAGCTCGTGTGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1184846259 22:47089604-47089626 GTCACTCTAGTCACCAGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 112
1184846257_1184846259 -6 Left 1184846257 22:47089587-47089609 CCGGCAGGGTGGGAGGTGTCACT 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1184846259 22:47089604-47089626 GTCACTCTAGTCACCAGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184846259 Original CRISPR GTCACTCTAGTCACCAGAGT GGG Intronic
902175559 1:14647603-14647625 GGCACTTCAGTCTCCAGAGTGGG - Intronic
902304831 1:15528003-15528025 GTCACTGTACTCACCAGAGATGG + Intronic
903203608 1:21763783-21763805 TTCTCTCTAGTTACCAGGGTTGG - Intronic
904054956 1:27663889-27663911 CCCACTTTAGTCACCAAAGTTGG + Intergenic
904142440 1:28364333-28364355 CTCACTCTTGTCACCAAAGCTGG + Intergenic
906399483 1:45494597-45494619 CTCATTCTACTCACCAGAATGGG + Intronic
906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG + Intergenic
909052543 1:70783851-70783873 TTCACTCTATTCACAAGAGCTGG - Intergenic
909632109 1:77778712-77778734 CTCACTCTAGTCACCCAGGTTGG + Intergenic
911162257 1:94693124-94693146 CTCACTCTAGTTCCCAGAGTAGG - Intergenic
912322531 1:108727685-108727707 GTCACTGTAGTCATCAGGGAGGG + Intronic
912485245 1:110021888-110021910 CTCACTCTAGTCACTAAAGAAGG + Exonic
912518983 1:110232618-110232640 ATCACCTGAGTCACCAGAGTTGG + Exonic
913673570 1:121120831-121120853 GTCACTCTAGTGTCCAATGTGGG - Intergenic
914025348 1:143908184-143908206 GTCACTCTAGTGTCCAATGTGGG - Intergenic
914663784 1:149815904-149815926 GTCACTCTAGTGTCCAATGTGGG - Intergenic
923705853 1:236344192-236344214 TTCACTCTTGTCACCCGAGCTGG - Intergenic
924135190 1:240958360-240958382 TTCAATCTAGTCTCCAGATTTGG - Intronic
1066255020 10:33670354-33670376 GTCACTCTTGTCACCTAGGTTGG + Intergenic
1068329552 10:55545195-55545217 GTCACTCAAGTCACTACAATTGG + Intronic
1070543943 10:77438091-77438113 TTCACTCTAGGCAACACAGTGGG - Intronic
1071375427 10:84997388-84997410 GCCAATCAAGTCACCAGAGTAGG - Intergenic
1073440853 10:103551881-103551903 TTCACTCAAGTGGCCAGAGTTGG + Intronic
1076388204 10:130074599-130074621 GTCACTGCAGGCACCAGAGGAGG + Intergenic
1086787066 11:90982367-90982389 GTCACTCTTGTCACCTGGGCTGG + Intergenic
1088051392 11:105519466-105519488 GTCACTCAAGTGATCAGACTGGG - Intergenic
1088931258 11:114352745-114352767 GTAACTAGAGCCACCAGAGTGGG + Intergenic
1089875665 11:121719347-121719369 GTCACTTTTTTCATCAGAGTAGG + Intergenic
1089884181 11:121803458-121803480 GTCAATAAAGTCACCAGAGCTGG + Intergenic
1094161364 12:27394314-27394336 GGGACTCAAGCCACCAGAGTTGG - Intronic
1097118669 12:56717259-56717281 GCAACTCCAGTCACCAGAGAAGG - Intronic
1105019845 12:132808740-132808762 GTCATGCTGGTCACTAGAGTGGG - Intronic
1106853122 13:33817040-33817062 GTTTCTCCAGTCAGCAGAGTTGG - Intergenic
1106970150 13:35129993-35130015 ATCACTCTATTCATCAGAGATGG - Intronic
1108466225 13:50718442-50718464 CTCATTCTAATCACCAGAGTGGG - Intronic
1110345995 13:74448548-74448570 GTCACAAAAGTCACCAGATTTGG - Intergenic
1111304859 13:86395737-86395759 GTAATATTAGTCACCAGAGTGGG - Intergenic
1114306765 14:21430787-21430809 TTCACTCAAGTCACCTGGGTAGG + Exonic
1118719469 14:68583959-68583981 GCCACTCCAGTCACCAGATGAGG + Intronic
1123508644 15:20972431-20972453 GTCACTGTAGTCACCACAGCTGG + Intergenic
1123565865 15:21546180-21546202 GTCACTGTAGTCACCACAGCTGG + Intergenic
1123602125 15:21983467-21983489 GTCACTGTAGTCACCACAGCTGG + Intergenic
1125744789 15:41990805-41990827 GTCACTCTAATCCCCAGAGTGGG + Intronic
1126149738 15:45512965-45512987 CTCACTCTTGTCACCCAAGTTGG - Intronic
1127173488 15:56328382-56328404 ATCACCATAGTCACCACAGTTGG - Intronic
1127894010 15:63278436-63278458 GTCTCTCTTGGCACCAGACTAGG + Intronic
1128135779 15:65262442-65262464 GTCATTCCAGTCTCCAGAGCTGG - Intronic
1129489951 15:75914995-75915017 TTCACTCTTGTCACCAAGGTTGG + Intronic
1130247708 15:82267730-82267752 GTGACTCTAGTTACTAGTGTAGG + Intronic
1202974234 15_KI270727v1_random:273273-273295 GTCACTGTAGTCACCACAGCTGG + Intergenic
1136508902 16:30723832-30723854 GTCACACTGGTCAACAGAGCTGG - Exonic
1139976002 16:70810787-70810809 GTCACTCTAGTCCACAGCCTGGG + Intronic
1140486685 16:75299214-75299236 GTCATTTCAGTCAGCAGAGTTGG - Intronic
1141593203 16:85082102-85082124 TTCACTCTTGTCAGGAGAGTGGG + Intronic
1143446192 17:7011385-7011407 GTCACTGTCCTCACTAGAGTGGG + Intronic
1146763230 17:35496316-35496338 CTCACTCTTGTCGCCAAAGTTGG - Intronic
1149334664 17:55623270-55623292 GGCACTCTAGTGTGCAGAGTAGG - Intergenic
1149832120 17:59881704-59881726 TTCACTCTTGTCACCAGGGCTGG + Intronic
1150058255 17:62039619-62039641 TTCACTCTTGTCACCAAGGTTGG + Intronic
1151065516 17:71144941-71144963 TTCACTCTAGTCACCCAGGTTGG - Intergenic
1152901192 17:82941965-82941987 GTCTCTCTAGTTACCAGGGTTGG + Intronic
1157826755 18:50819475-50819497 GTCACTCTGGTCACCAGTATGGG - Intronic
1162530443 19:11233062-11233084 GTCACTCTGGGCAGCAGAGTTGG - Intronic
1163981109 19:20901040-20901062 GACACTCAATTCACCACAGTGGG + Intergenic
1164050859 19:21585152-21585174 TCCACTCTGGTCAACAGAGTGGG + Intergenic
1166084924 19:40468105-40468127 TTCACTCTTGTCACCCAAGTTGG + Intronic
926524489 2:13960190-13960212 TTCACTCTTGTCACCTGGGTTGG + Intergenic
927173488 2:20389538-20389560 CTCACTCTTGTCCCCACAGTGGG + Intergenic
927449930 2:23199842-23199864 GTGACTCTTATCACCAGAGATGG + Intergenic
928455782 2:31420266-31420288 GTCACACTTGGCACCAGAGTGGG + Intergenic
933809297 2:86022616-86022638 CTCACTCTTGTCACCCGAGCTGG + Exonic
935078627 2:99770558-99770580 CTCACTATAGCCACCACAGTTGG + Intronic
937559555 2:123205425-123205447 CTCACTATAGCCACCACAGTTGG + Intergenic
938565319 2:132513739-132513761 GTCACTCTGGCCCCCCGAGTGGG + Intronic
941284802 2:163597446-163597468 TTCACTCTAGTCACTCAAGTTGG + Intronic
945843500 2:214915876-214915898 GTCACCCAGTTCACCAGAGTGGG - Intergenic
1169672782 20:8122457-8122479 GTTACTCCAGTAAACAGAGTTGG + Intergenic
1172759080 20:37309403-37309425 GTCACTGGGGTCACAAGAGTAGG - Intronic
1179598900 21:42462366-42462388 GCCACTCTAAGCACCAGAGTAGG + Intergenic
1181548413 22:23619139-23619161 CTCACTCTTGTCACCATACTGGG - Intronic
1182758140 22:32697790-32697812 GTCAGTCAAGTGACCAGACTCGG - Intronic
1184846259 22:47089604-47089626 GTCACTCTAGTCACCAGAGTGGG + Intronic
952743760 3:36759384-36759406 GCCACTGTAGTCACCAGTGCAGG - Intergenic
953882918 3:46700925-46700947 GTCACCCTGGACACCAGAGCTGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
957653130 3:83035269-83035291 CTCACTCTGGTCAGCAGAGCTGG + Intergenic
961643174 3:128378091-128378113 GGTACTCTAGTCCCCAGTGTAGG - Intronic
968292589 3:197550335-197550357 GACATTCCAGTCACCAGATTAGG + Intronic
969817763 4:9698881-9698903 GTCACCCTAGAGACCAGAGAGGG + Intergenic
970062858 4:12054719-12054741 TTCACTCTGGTCACCAGGCTTGG + Intergenic
975720676 4:77245834-77245856 GTCACTGTAGTCAGGAGAGAAGG - Intronic
978581227 4:110233116-110233138 GTCACTCTAGTGCCCTGGGTAGG - Intergenic
980750699 4:137083716-137083738 ATTACTTTAGTCATCAGAGTAGG - Intergenic
984583090 4:181533172-181533194 CTCACTATAGACACCAGAGCAGG - Intergenic
992211986 5:74489288-74489310 CCTGCTCTAGTCACCAGAGTTGG + Intergenic
993279371 5:85905475-85905497 TTCACTCTAGCCACCACAGCTGG - Intergenic
1001112033 5:168904634-168904656 GTCATTCTTGTCCCCAGAGCTGG - Intronic
1003147813 6:3523515-3523537 GTGACTCTAGTGAACAGGGTAGG - Intergenic
1003179849 6:3782198-3782220 GTCACTCTCTTCCCCAGACTTGG + Intergenic
1007621782 6:43219898-43219920 GTCCCCCTCGTCACCAGTGTTGG - Intronic
1008063240 6:47020472-47020494 GTCACTCTTGTCGCCCAAGTTGG - Intronic
1010363357 6:75020746-75020768 GTCACTCTAGTAACCAAATTAGG + Intergenic
1011158306 6:84358376-84358398 CTTACTCTGGTCACCAGAATTGG + Intergenic
1011755104 6:90490610-90490632 GTCACTTTTGACAACAGAGTTGG - Intergenic
1015876067 6:137824123-137824145 AACACTGTAGTCACCAGACTTGG - Intergenic
1016012887 6:139157222-139157244 GTCACTCTCGTCACCATTTTGGG + Intronic
1016136882 6:140554989-140555011 TTCACCATAGTCACTAGAGTTGG + Intergenic
1022448627 7:30493156-30493178 GTTTCTCTTGTCACCAAAGTGGG + Intergenic
1026831073 7:73610493-73610515 CTCACTCTTGTCACCCAAGTTGG + Intronic
1031103465 7:117511094-117511116 GTGACTCTAGTAACCAGCCTTGG + Intronic
1033756028 7:144398906-144398928 GTCACTCTAGTTATCTGGGTGGG - Intronic
1034952839 7:155312707-155312729 GTCACAGTGGCCACCAGAGTGGG + Intergenic
1037316851 8:17607286-17607308 GTCGATCTAGTCATTAGAGTAGG + Intronic
1037748557 8:21665034-21665056 CTCACTCCAGTCAGCAGATTGGG - Intergenic
1044026125 8:87174950-87174972 GTCACTCTAGTCTCCACACCAGG - Intronic
1045733433 8:105267565-105267587 TTCACTGTAGTCACCACAGCTGG + Intronic
1046985035 8:120378526-120378548 GACACTCTAGTTATCAGATTTGG + Intergenic
1187493280 X:19772825-19772847 GTCACACCTGTCACAAGAGTGGG - Intronic
1188133676 X:26468691-26468713 GTCACTCTCGTCACCATCTTGGG + Intergenic
1193305788 X:79949699-79949721 TTCACTCTAGCCACCACAGCTGG - Intergenic
1195090120 X:101450643-101450665 TTCACCATAGCCACCAGAGTTGG + Intronic
1197430872 X:126362038-126362060 GTGACTCTAGTCAACAGTGAAGG + Intergenic
1197558862 X:127992513-127992535 CTCATTATAGTCACCACAGTTGG - Intergenic
1199325199 X:146490662-146490684 TTCACTCTAGCCACCACAGCTGG - Intergenic
1200327487 X:155257236-155257258 GTAACTGAAGTCACGAGAGTGGG + Intergenic
1201448922 Y:14088878-14088900 TTCACTCAAGTCACCAAACTTGG + Intergenic
1202247356 Y:22833563-22833585 ATCACTCTATTCAAGAGAGTGGG - Intergenic
1202400344 Y:24467311-24467333 ATCACTCTATTCAAGAGAGTGGG - Intergenic
1202470436 Y:25202775-25202797 ATCACTCTATTCAAGAGAGTGGG + Intergenic