ID: 1184847021

View in Genome Browser
Species Human (GRCh38)
Location 22:47094512-47094534
Sequence GGCTTGATGAGAACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184847021 Original CRISPR GGCTTGATGAGAACAAAATC TGG (reversed) Intronic
901702407 1:11052754-11052776 GCCTTGATGAGGACACAACCTGG - Intergenic
902114496 1:14109967-14109989 GGACTGAAGAGAACAAAATTGGG - Intergenic
902735472 1:18397903-18397925 GGACTGATGAGAAGGAAATCAGG + Intergenic
904000395 1:27335530-27335552 GGGGTGAGGAGAAAAAAATCTGG - Exonic
907982922 1:59502419-59502441 GGCTAGGTGAGAACAAAATAGGG + Intronic
910285815 1:85552966-85552988 GGCTAGATGAGAAAAAAAAGAGG + Intronic
910352714 1:86317754-86317776 AGCTTGAAGAGAGCAAAATTTGG + Intergenic
913574398 1:120156204-120156226 GGCTTCATGAGAACAAAGGCAGG - Exonic
914048949 1:144115323-144115345 GGCGTGATGAAAACAAACTTTGG + Intergenic
914130235 1:144850125-144850147 GGCGTGATGAAAACAAACTTTGG - Intergenic
914295668 1:146321011-146321033 GGCTTCATGAGAACAAAGGCAGG - Intergenic
914556708 1:148771792-148771814 GGCTTCATGAGAACAAAGGCAGG - Intergenic
914616126 1:149358438-149358460 GGCTTCATGAGAACAAAGGCAGG + Intergenic
914875469 1:151510338-151510360 AACTAAATGAGAACAAAATCCGG + Intergenic
915236271 1:154485274-154485296 GGCTGGAGGAGAACAGAGTCGGG - Intronic
916928240 1:169546533-169546555 TGTTTGATGAGAACAAAAGCTGG - Exonic
920649133 1:207823731-207823753 GGTTTGATGGGACCAAATTCTGG - Intergenic
920937323 1:210447728-210447750 AGCTTGGTGAGAAAGAAATCAGG - Intronic
921200856 1:212804701-212804723 TGCTTTATGAGAACATAAACTGG - Intronic
924330409 1:242935700-242935722 GGATTGATGTGAACAAATGCAGG - Intergenic
1063737536 10:8777354-8777376 GGCTTCCTGAGTATAAAATCTGG + Intergenic
1064259012 10:13769739-13769761 GGCTTGAATAGAACAAAAGATGG + Intronic
1064281215 10:13953235-13953257 GGGTAGATGAGAACAAAAACAGG - Intronic
1066090194 10:32010725-32010747 GACTTGTTGAGTACAGAATCAGG + Exonic
1067328291 10:45290846-45290868 GGCTTGATGAGGGCAGAATAAGG + Intergenic
1068248088 10:54399432-54399454 AGCTTGATGACAAGAACATCAGG + Intronic
1068263970 10:54623617-54623639 GGCTTGAAGAGCCCAAAATATGG - Intronic
1068444111 10:57097896-57097918 GCTGTGATGAGAACAAAAACTGG - Intergenic
1069215224 10:65811666-65811688 GGCCAGATAAGAATAAAATCAGG - Intergenic
1076447319 10:130525556-130525578 GGGTTGATGAAACCAAAAGCAGG - Intergenic
1078098429 11:8314319-8314341 GGACTGGTGAGAACAAAGTCTGG - Intergenic
1078305553 11:10182213-10182235 AGCTTTATGAGATCAAAATGGGG + Intronic
1078319272 11:10319151-10319173 GGATTGATGAGAACAGGACCAGG + Intronic
1078954280 11:16172513-16172535 GGAATGATGAGATCAAATTCAGG - Intronic
1079650647 11:22924139-22924161 GGCTTCATTTGAACAAAAGCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082304362 11:50553094-50553116 GTCTTGATGGTAACCAAATCTGG - Intergenic
1086386806 11:86317450-86317472 GGCTCAATGAAACCAAAATCTGG + Intronic
1090505226 11:127304663-127304685 GGCTAGTTGAGAACCAAAACTGG + Intergenic
1090515107 11:127416587-127416609 GGCTGGATGATAAAGAAATCAGG - Intergenic
1090949024 11:131456451-131456473 GGCTTGATGAGAACGAAGGAGGG - Intronic
1093531337 12:20168331-20168353 TGCTTCATGAAAAGAAAATCTGG + Intergenic
1099722324 12:86380666-86380688 GTCTTCATGAGAACACAATAAGG + Intronic
1100722926 12:97377975-97377997 GGCTTGGTAAGTCCAAAATCTGG + Intergenic
1100782971 12:98048912-98048934 GGCTTGAACAGAACAAAAAGTGG + Intergenic
1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG + Intergenic
1104698354 12:130881818-130881840 GGACTTATAAGAACAAAATCTGG + Intergenic
1110015082 13:70390065-70390087 GGCTTAATGAGTATAAAAACTGG - Intergenic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1111697626 13:91644990-91645012 AGCTTTATGAGCACAAAACCTGG - Intronic
1112848468 13:103673539-103673561 GGCTAGATGAGCAGAAAATGGGG - Intergenic
1114527019 14:23372861-23372883 GGCTTGCTGAAAATAAAATCAGG + Exonic
1115839709 14:37455344-37455366 AATTTGAAGAGAACAAAATCAGG - Intronic
1116127664 14:40808738-40808760 GGCTTCAGGAGAACTAAAGCAGG + Intergenic
1116552225 14:46255815-46255837 GAGTTGATGAGAAAAAAATGTGG - Intergenic
1117064063 14:51991347-51991369 GGCTTGAAGACCAGAAAATCAGG + Exonic
1117414297 14:55479522-55479544 GGCTTGCTGAGTCCAAAATCTGG + Intergenic
1123418887 15:20114926-20114948 GGCGTGATGAAAACAAATTTTGG + Intergenic
1123446980 15:20338609-20338631 GGCGTGATGAAAACAAACTTTGG - Intergenic
1123528108 15:21121465-21121487 GGCGTGATGAAAACAAATTTTGG + Intergenic
1124024156 15:25949207-25949229 GGCTTGAGTAGAACAAAAGGAGG + Intergenic
1128483648 15:68062727-68062749 GTCTAGATGAGAACAAAACTAGG + Intronic
1136293563 16:29289798-29289820 GGCCTGCTGAGAACAAACCCTGG + Intergenic
1138662388 16:58530152-58530174 GGCTTAATAAAAACAAAATAAGG + Intronic
1142024175 16:87803684-87803706 GGCTTGGTGAGGACCAAAACAGG + Intergenic
1142099446 16:88263804-88263826 GGCCTGCTGAGAACAAACCCTGG + Intergenic
1203138236 16_KI270728v1_random:1743865-1743887 GGCGTGATGAAAACAAACTTTGG - Intergenic
1145283012 17:21481714-21481736 AGATTGATGAGAAATAAATCTGG + Intergenic
1150792355 17:68208566-68208588 GGCCTGATAAGAATAAAAGCAGG + Intergenic
1150838308 17:68584461-68584483 GGCTTGGTAAGGACAACATCTGG + Intronic
1150940680 17:69690245-69690267 GGCAGGATGAGAACCAAATGTGG + Intergenic
1151997876 17:77622046-77622068 GGGTTGAGGAAAACAAAAACAGG - Intergenic
1154182931 18:12153016-12153038 GTCAAGATGAGAACGAAATCAGG + Intergenic
1159384780 18:67709545-67709567 GGTTTCATTAGAACAAAATAAGG + Intergenic
1164261699 19:23573414-23573436 GGCTTAATAAGATCAAAATTTGG - Intronic
1166410580 19:42553596-42553618 GGCTTTCTGAGAACAGAGTCTGG + Intronic
1202688400 1_KI270712v1_random:68226-68248 GGCGTGATGAAAACAAACTTTGG + Intergenic
927441038 2:23118095-23118117 GGCTCCATGAGAACAATATCTGG - Intergenic
928499798 2:31878527-31878549 GTCTTGGTGGGAAGAAAATCAGG + Intronic
930930703 2:56878396-56878418 GCCAAGCTGAGAACAAAATCAGG + Intergenic
932988009 2:76750238-76750260 GGCTTGATGAGATCAAATGTTGG - Intronic
935718961 2:105962624-105962646 GGCTGGATGGGAACCAAATATGG + Intergenic
936264235 2:110988657-110988679 GGGTTGGTGAGAACAGAATAAGG - Intronic
937443389 2:121935946-121935968 GGCTTGCTGATGACAAAAACTGG + Intergenic
938844485 2:135194873-135194895 GGATTTATTTGAACAAAATCAGG + Intronic
941001522 2:160207708-160207730 GGCCTTGTGAGAACAAAATAGGG - Intronic
945540562 2:211081293-211081315 GGCTAGATTAGAAAAAAAACAGG + Intergenic
946216048 2:218184350-218184372 GGCATCATGAGAAAAACATCAGG + Intergenic
947878156 2:233481449-233481471 TGCTCGATGAAAACAAACTCGGG + Intronic
1177717162 21:24853790-24853812 GCCTTGTTGAGACCAAAATTTGG + Intergenic
1178164377 21:29955985-29956007 TTCTTGATGAGAACACAATGAGG + Intergenic
1178746697 21:35258486-35258508 GACTTGATTATACCAAAATCTGG - Intronic
1178919621 21:36729928-36729950 GGCTCGATGAGAACACAAAGGGG + Intronic
1182511013 22:30820458-30820480 GGCCTCATGAGAAAAAAATGAGG - Intronic
1183095671 22:35550707-35550729 AGCTAGGTGAGAACAGAATCAGG + Intronic
1184847021 22:47094512-47094534 GGCTTGATGAGAACAAAATCTGG - Intronic
949607477 3:5670179-5670201 GGCTTGGTGAGTCCAAAATTTGG + Intergenic
951935465 3:28017936-28017958 GACTTGGTGTGAAAAAAATCTGG + Intergenic
951995960 3:28729189-28729211 GGCTTGATAAGAAAAAACTCAGG - Intergenic
952888234 3:38024772-38024794 GGCGGGACGAGAAGAAAATCTGG + Exonic
956245198 3:67175145-67175167 GGCTTGAAGAGAACAAAAGTGGG - Intergenic
957275457 3:78085474-78085496 GGCTTGACTAGAACAAAGTCAGG - Intergenic
958080959 3:88745583-88745605 GGCTTCATGAGAAAAAATTTGGG + Intergenic
958832100 3:99101652-99101674 GGCCTGAAGAGAACAAAAAGTGG - Intergenic
958921992 3:100117439-100117461 GGCTATATGAGAAAAAAATAAGG + Intronic
959854935 3:111141352-111141374 GGCCTGAAGAGAAAAAAATAGGG + Intronic
960639451 3:119812135-119812157 GGCTTTATGAGGACAGGATCAGG + Intronic
962114961 3:132495087-132495109 GGCATGATGAGAGCAAGATTAGG + Exonic
962671561 3:137714109-137714131 GGCCAGCTAAGAACAAAATCGGG - Intergenic
963007070 3:140736226-140736248 GGGTTGTTGAGAAAAAAATTAGG + Intergenic
963077681 3:141362564-141362586 GGCAGGAAGAGAAGAAAATCAGG - Intronic
963851654 3:150216000-150216022 GGTTGGGTGAGAAAAAAATCAGG + Intergenic
964014261 3:151927554-151927576 GGCTTGAGGAGAACAGAAAAGGG + Intergenic
966413796 3:179669016-179669038 GGCTTGATGAAAGCAAAAGTTGG + Intronic
966421369 3:179737899-179737921 GTCTTGCTGAAAACATAATCTGG - Intronic
966584193 3:181603427-181603449 GCCTTCAGGAGAACAAAGTCAGG - Intergenic
971071568 4:23098857-23098879 GGCTTAGTGAGTCCAAAATCTGG - Intergenic
972638100 4:40902115-40902137 ATGTTGATGAGAAAAAAATCTGG + Intronic
973960272 4:56102932-56102954 GGCTTTATGAGCACAAAGTAGGG - Intergenic
974847768 4:67371694-67371716 GGCTTGAGTAGAACAAAAGGTGG - Intergenic
979226075 4:118286420-118286442 GACTTGATCAGGACAAAATCAGG - Intronic
979976640 4:127204795-127204817 GACTTGATGATCATAAAATCTGG - Intergenic
982429891 4:155310796-155310818 GGAGTGATGGGAACAAAAACTGG + Intergenic
982874757 4:160632996-160633018 GGCTTGAAGAGAGCAAAAACTGG - Intergenic
983903008 4:173156676-173156698 GACTTGATAACAACTAAATCTGG + Intergenic
986345565 5:6831968-6831990 GATTTGATGAGTCCAAAATCTGG - Intergenic
986932419 5:12842761-12842783 GGTTTGAAGAGAAAAAAATGAGG + Intergenic
989010622 5:36868105-36868127 GGCTTCCAGTGAACAAAATCAGG - Intergenic
993802143 5:92355264-92355286 GGGCTTATGAGAACAAAAGCAGG - Intergenic
994977136 5:106823141-106823163 AGCTTGATGATAGCAAGATCTGG - Intergenic
995668451 5:114571809-114571831 GTCTAGCTGAGAACGAAATCAGG - Intergenic
997759822 5:136434256-136434278 AGCTTTCTGAGATCAAAATCTGG + Intergenic
1001553794 5:172622746-172622768 GACTTTATGACAACAAACTCAGG + Intergenic
1002630779 5:180575144-180575166 TGCTTGGTGAGAACAAATTTAGG - Exonic
1003489098 6:6606070-6606092 GGCCAGATGAGAATAAAAGCAGG - Intronic
1004082137 6:12405174-12405196 GGCTTGAGGAGTACAGAATTGGG + Intergenic
1008894928 6:56542135-56542157 GCCTTGATGTGAACAATACCAGG - Intronic
1008961218 6:57268217-57268239 GACTTGAAGGGAACAAAATGTGG - Intergenic
1010314664 6:74433712-74433734 TGCTTGATGATAAAAAAATAAGG + Intergenic
1016453828 6:144210660-144210682 GGGTTGATGGGAAGAAAAGCAGG - Intergenic
1019133676 6:169895235-169895257 GGCTTGAAGAGAATCAAATTAGG + Intergenic
1020008398 7:4794280-4794302 GGCCAGATGAGAATAAAAGCAGG + Intronic
1020790847 7:12626807-12626829 GGCTTGATAAAAACAAAAACAGG - Intronic
1022774666 7:33513624-33513646 GGTTTTATAAGAACAAAACCTGG + Intronic
1025779275 7:64585337-64585359 GGCTTAATAAAAACAAAATATGG - Intergenic
1029196236 7:98807419-98807441 GGGCAGCTGAGAACAAAATCAGG - Intergenic
1030723361 7:112896158-112896180 GGGTTTATGATAACAAAGTCAGG + Intronic
1031080925 7:117256250-117256272 GGATTGATGAGAAGAAAGTCTGG + Intergenic
1031247194 7:119329379-119329401 GTCTTGAGGAGAAGAAAGTCAGG - Intergenic
1031536831 7:122944951-122944973 GACTTGATGAGAATTAATTCTGG + Intergenic
1037256394 8:16960293-16960315 TGCTAGATAAGAAGAAAATCAGG - Intergenic
1041610804 8:59845873-59845895 GCCGTGAAAAGAACAAAATCTGG + Intergenic
1042150804 8:65781449-65781471 GGTGTGATGAGAACAGAGTCAGG + Intronic
1042518297 8:69683069-69683091 GGCTTGAAGAAAATAAATTCAGG + Intronic
1043542246 8:81277292-81277314 TCCTAGATGAGAATAAAATCAGG - Intergenic
1047693873 8:127384015-127384037 GGCTTGATGAGGAGAAACTAAGG - Intergenic
1048563184 8:135564927-135564949 GGGTTGATGGGAAGAAAAGCAGG + Intronic
1050145073 9:2559196-2559218 ACCTTCATAAGAACAAAATCAGG + Intergenic
1050937643 9:11418707-11418729 TCCTTGATCATAACAAAATCTGG + Intergenic
1051427035 9:16942521-16942543 ATCTTGAGGAGAAAAAAATCAGG + Intergenic
1052730722 9:32282047-32282069 GGTTTGCTGAGAACAGAACCTGG + Intergenic
1055972071 9:81921447-81921469 GGCTTTAAGAGAACAAAATTGGG + Intergenic
1055973824 9:81936519-81936541 GGCTTTAAGAGAACAAAATTGGG + Intergenic
1057791243 9:98126603-98126625 GGCTGGAGGAGAAGAAAACCTGG - Exonic
1058660195 9:107259247-107259269 GGCTTTCTGAGCACAAAATAAGG - Intergenic
1060684907 9:125600694-125600716 GGCTGGATGAGAAGAGAATGTGG - Intronic
1188674273 X:32919208-32919230 GGCTTGAAAAGATCAAAATCAGG + Intronic
1190755327 X:53396397-53396419 GGCTAGGTGAGACCCAAATCTGG + Intronic
1191135059 X:57055232-57055254 GGCATCATGATACCAAAATCTGG - Intergenic
1192242381 X:69343404-69343426 GGCTTTATAAAAACAAAAACAGG - Intergenic
1192803824 X:74492974-74492996 TGCTGGATGAGAAAAACATCGGG - Intronic
1193030628 X:76894422-76894444 GCCAAGATGAGAACCAAATCAGG + Intergenic
1193365943 X:80633380-80633402 GTCTTGAAGAAAACAAAATGTGG - Intergenic
1201227771 Y:11834834-11834856 GGATTGATGTGAACAAATGCAGG - Intergenic
1201382794 Y:13402511-13402533 GGCTTCATGAGAGCAAAATTTGG - Intronic
1201885897 Y:18880991-18881013 GGCCAGATAAGAATAAAATCAGG + Intergenic