ID: 1184848706

View in Genome Browser
Species Human (GRCh38)
Location 22:47105307-47105329
Sequence GGTGTATTCATACCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184848706_1184848709 18 Left 1184848706 22:47105307-47105329 CCTGTTTTTGGTATGAATACACC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1184848709 22:47105348-47105370 TTTAAGAAACATAACCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184848706 Original CRISPR GGTGTATTCATACCAAAAAC AGG (reversed) Intronic
901935921 1:12626784-12626806 GGGCTTTTCATTCCAAAAACAGG - Intergenic
901987481 1:13087379-13087401 GGCGTATTTATACAAACAACTGG + Intergenic
901994331 1:13139388-13139410 GGCGTATTTATACAAACAACTGG - Intergenic
905701107 1:40015194-40015216 AGTATATGCATACCAAAAAAAGG - Intergenic
907110396 1:51921685-51921707 AGTGTCTTCCTACCAAGAACAGG + Intronic
908919160 1:69169376-69169398 GATGAAGTCATACCAAAAACTGG - Intergenic
909291661 1:73890666-73890688 GGTGTATTGTTACAAAAAACAGG - Intergenic
909291665 1:73890724-73890746 GGTGTATTGTTACAAAAAACAGG - Intergenic
910873598 1:91856836-91856858 GGTTTATTCATCCCACACACAGG + Intronic
919656903 1:200206040-200206062 GATCTATTTATTCCAAAAACGGG + Intergenic
922444075 1:225681832-225681854 GGTTTATTTATACTAAAAACAGG - Intergenic
1065084088 10:22156870-22156892 CGTGTATTCATCCAAAAAAATGG - Intergenic
1067361937 10:45590390-45590412 GGTTTTCTCATACCAAACACTGG + Intronic
1067660293 10:48232278-48232300 GTTGTTTTCAGACCAAAAAAGGG - Exonic
1068599900 10:58945922-58945944 GGGGTATCCATACCAAGAAGGGG + Intergenic
1069960720 10:72077621-72077643 GGTGTCTTCACCCCAAACACGGG + Intronic
1072220019 10:93318962-93318984 GGTGCTTTCATTCCAAAAAAGGG - Intronic
1076315818 10:129540770-129540792 GGTGCATTCATCCCAAAATTTGG - Intronic
1081241489 11:40711376-40711398 GGTATACTCATACCCAAAACAGG + Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081735859 11:45403624-45403646 TTTGTATTCAAACCCAAAACTGG + Intergenic
1086399676 11:86450227-86450249 GGTGGAAGCATACCAAAAAAGGG - Intronic
1087831245 11:102821829-102821851 GATGTATTCATTCCTTAAACAGG - Intergenic
1096392930 12:51243366-51243388 GGAGTTTTCAGATCAAAAACTGG + Intronic
1098308449 12:69124499-69124521 GGTTTAATCACACCAAAAAAAGG - Intergenic
1104036946 12:125104276-125104298 GGTGTCTTCATACCAGCCACGGG + Intronic
1109778091 13:67070215-67070237 TGTGTGTTCCTACCAAAAAAAGG + Intronic
1110260182 13:73475901-73475923 GGTGTATTTATACCAGAAAAGGG - Intergenic
1112252797 13:97798924-97798946 GATGTTTTTACACCAAAAACAGG + Intergenic
1113998700 14:16122399-16122421 GATGTATTCACACCACAAAGAGG + Intergenic
1124082962 15:26518093-26518115 GGTGTAAGCATACAATAAACTGG + Intergenic
1126620397 15:50633657-50633679 GGTGTATTTATACAAAGAAATGG - Intronic
1127020455 15:54741166-54741188 AATGTATACATACCCAAAACTGG + Intergenic
1131365894 15:91839248-91839270 TCTGTATGCATAACAAAAACTGG + Intergenic
1132106958 15:99069837-99069859 GGTGAATTCATAGCAGCAACGGG - Intergenic
1133775932 16:8895033-8895055 GGTGTATCCTCAGCAAAAACGGG + Exonic
1133803724 16:9106834-9106856 GTTGAATTAATACCAACAACTGG + Intronic
1138092464 16:54187178-54187200 TGTGTTTTGATACCAAAAAAAGG + Intergenic
1141084199 16:81079867-81079889 GGTTTATTAAAACCTAAAACTGG + Intergenic
1144100794 17:11940540-11940562 GGTGCTGTCATAGCAAAAACTGG - Intronic
1152278494 17:79371896-79371918 GTTCAATTCATACCAAAACCAGG + Intronic
1152651393 17:81495166-81495188 GGTGTCTTCACACCATAAGCAGG - Intergenic
1155975080 18:32120122-32120144 GGTGTATTCCCACTAAAATCAGG - Intronic
1156198138 18:34799060-34799082 TGTGTATAAATACCAGAAACTGG - Intronic
1158545978 18:58397281-58397303 GGTGCATTTACAACAAAAACTGG - Intronic
1164015749 19:21254652-21254674 TGTGTATTCTTGCCAAAAACAGG - Intronic
1165653732 19:37514684-37514706 GTTGCATTGATTCCAAAAACTGG + Intronic
926831519 2:16967660-16967682 GGGGTAATAATACCAAGAACAGG + Intergenic
929397720 2:41542606-41542628 TATGTCTTCATATCAAAAACTGG + Intergenic
938111292 2:128567467-128567489 TGTTTAGTCATACCTAAAACAGG + Intergenic
939880692 2:147627814-147627836 GGTGTATCCATGCCAATATCAGG + Intergenic
946986524 2:225280036-225280058 GTTGTATTGATACCAGAAAGAGG - Intergenic
1170348780 20:15417232-15417254 GGTGTAGCCATACAAAAAAAGGG + Intronic
1171099215 20:22366879-22366901 GTTGAATTCATACCAAAGAAGGG - Intergenic
1171762875 20:29226236-29226258 GATGTATTCACACCACAAAGAGG - Intergenic
1174069532 20:47889915-47889937 GGTGTCTTCACACCCAGAACTGG + Intergenic
1177878018 21:26658543-26658565 TATGTTTTCATACCAATAACTGG - Intergenic
1182840366 22:33384493-33384515 GGTGTATTCGTCTCCAAAACAGG - Intronic
1183410269 22:37650832-37650854 AGTGTTTTCATCCCAAAGACCGG + Intronic
1183767241 22:39889750-39889772 GTTGTATTTTTACCAAAAAGAGG - Intronic
1184848706 22:47105307-47105329 GGTGTATTCATACCAAAAACAGG - Intronic
956941795 3:74170562-74170584 GCTGTGTTCATGGCAAAAACAGG + Intergenic
957415931 3:79904930-79904952 GGTGTACTCAAGCCAAAGACAGG - Intergenic
960229350 3:115207119-115207141 GGGGTATTCATAGCCAAACCTGG + Intergenic
962587616 3:136858582-136858604 GGGGAACTCAAACCAAAAACAGG - Intergenic
963626580 3:147680981-147681003 GATGTATTCATACACAAAAATGG + Intergenic
970671833 4:18405502-18405524 GGAATATTCATACCATAACCTGG + Intergenic
972274593 4:37545295-37545317 AGGGGTTTCATACCAAAAACAGG - Intronic
974984060 4:68997088-68997110 GGTGTAAACATAAGAAAAACTGG - Intergenic
983735744 4:171057692-171057714 GGTTTACTCATAACAAAGACAGG - Intergenic
984082749 4:175268855-175268877 GGTGTGTTCAGACCTAAGACAGG - Intergenic
986924467 5:12730379-12730401 GGTGTTTTAATTTCAAAAACTGG + Intergenic
988258477 5:28851037-28851059 GATGTATTCCTAACAAAACCAGG - Intergenic
988488466 5:31687160-31687182 GGAGTGTTCATACCAAAGTCAGG + Intronic
989270459 5:39526981-39527003 AGTGTATTCTTTCAAAAAACAGG + Intergenic
990016858 5:51073738-51073760 GGTAAATTCATACCCAAGACTGG + Intergenic
990165904 5:52992956-52992978 GGTGTAGTCATAACAAAGAATGG - Intronic
991683944 5:69164992-69165014 GTTATATTCATACCAAAACTTGG + Intergenic
992160422 5:73995442-73995464 AATGTATTCTTACCAGAAACAGG + Intergenic
992883140 5:81130533-81130555 GGTGTACTCAGAGCAGAAACAGG + Intronic
993761464 5:91801521-91801543 GGTAAAGACATACCAAAAACTGG + Intergenic
997049086 5:130357675-130357697 GGTTTTCTCATACCAAGAACAGG + Intergenic
999433993 5:151548838-151548860 GGTTTCTTCATCTCAAAAACGGG - Intronic
1005251114 6:23947314-23947336 GGTTTGTTCATACAAAAAAAAGG + Intergenic
1005636810 6:27760763-27760785 GGTACATGTATACCAAAAACAGG + Intergenic
1011252579 6:85388332-85388354 GGTGTATTCCTACCACTAAAGGG - Intergenic
1016102944 6:140125995-140126017 GGAGATTTCATACCTAAAACTGG - Intergenic
1020769628 7:12372618-12372640 ACTGTATTCATTTCAAAAACTGG + Intronic
1022938093 7:35201853-35201875 CGTGTATTCATCCACAAAACAGG + Intergenic
1024062181 7:45707252-45707274 GCTTTATTCATAATAAAAACTGG + Intronic
1026521725 7:71123657-71123679 GGTTTATTCATAGCAACAACAGG + Intergenic
1029688805 7:102166713-102166735 GGAGAATTCAAACTAAAAACAGG - Intronic
1030473791 7:110002078-110002100 GATGTATTCAAACCAAATAAAGG - Intergenic
1038171049 8:25132660-25132682 GGTATAATTATACAAAAAACCGG - Intergenic
1038774877 8:30519976-30519998 GATGTATTCATACCCAGAAATGG - Intronic
1042379617 8:68097656-68097678 GTTGTATGCATACCAAATAGTGG - Intronic
1043246582 8:78010809-78010831 GGTCTGTTAATACCATAAACAGG - Intergenic
1045432883 8:102129709-102129731 GGTACATTCATACCATAAAAAGG - Intergenic
1048379688 8:133854315-133854337 GGTGCATCCTTACCCAAAACAGG - Intergenic
1050302733 9:4275841-4275863 GATGTCTTCATACCTAAAATGGG + Intronic
1051030713 9:12673564-12673586 AGTATATTTTTACCAAAAACAGG + Intergenic
1053663519 9:40301107-40301129 TGTGTGTTCATAACAAAAAGGGG + Intronic
1053914027 9:42931646-42931668 TGTGTGTTCATAACAAAAAGGGG + Intergenic
1054375642 9:64447341-64447363 TGTGTGTTCATAACAAAAAGGGG + Intergenic
1054521095 9:66075178-66075200 TGTGTGTTCATAACAAAAAGGGG - Intergenic
1056142869 9:83700533-83700555 GATGAATTCTTATCAAAAACAGG + Intronic
1058494048 9:105535199-105535221 GGTGTATCCATGTCAACAACTGG + Exonic
1203402341 Un_KI270519v1:122113-122135 GGTGTATGCATCTCAAAGACTGG - Intergenic
1192001192 X:67153448-67153470 GGTGTATTTCAACCAAAAACAGG - Intergenic
1194067785 X:89283951-89283973 GGTGTGTTCAGGCCAAAAACAGG - Intergenic
1195806870 X:108783262-108783284 GGTGTAATTATACTAATAACAGG - Intergenic
1197553222 X:127920742-127920764 TATGTATTGATACCAAAACCTGG + Intergenic
1198386714 X:136135596-136135618 GTTGTATTCCTGCCAAAAATGGG + Intergenic
1200721931 Y:6618111-6618133 GGTGTGTTCAGGCCAAAAACAGG - Intergenic
1200942262 Y:8797118-8797140 TGTCTATTCATGGCAAAAACAGG + Intergenic
1201500504 Y:14637422-14637444 GGTGTATTCATAACACATAATGG - Intronic