ID: 1184849513

View in Genome Browser
Species Human (GRCh38)
Location 22:47112286-47112308
Sequence CTGGGTGAACACTGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 328}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184849513_1184849519 -9 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849519 22:47112300-47112322 TTCACCCAGCAGAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 253
1184849513_1184849523 17 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849523 22:47112326-47112348 AGCAAGGAAGACCCCAGCAGTGG 0: 1
1: 0
2: 3
3: 30
4: 286
1184849513_1184849524 18 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849524 22:47112327-47112349 GCAAGGAAGACCCCAGCAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 191
1184849513_1184849528 30 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849528 22:47112339-47112361 CCAGCAGTGGGAAGCAGACCAGG 0: 1
1: 1
2: 1
3: 26
4: 348
1184849513_1184849522 1 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849522 22:47112310-47112332 AGAGGGCTCTGGGTGCAGCAAGG 0: 1
1: 1
2: 3
3: 45
4: 388
1184849513_1184849518 -10 Left 1184849513 22:47112286-47112308 CCTTCTGCCCAGTGTTCACCCAG 0: 1
1: 0
2: 2
3: 18
4: 328
Right 1184849518 22:47112299-47112321 GTTCACCCAGCAGAGGGCTCTGG 0: 1
1: 2
2: 6
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184849513 Original CRISPR CTGGGTGAACACTGGGCAGA AGG (reversed) Intronic
900407055 1:2497370-2497392 TTGGGTGAACGAGGGGCAGACGG + Intronic
900653283 1:3741869-3741891 GTGGGTGAACTTTGGGCAGACGG + Intergenic
900946477 1:5833978-5834000 CAGAGGGGACACTGGGCAGAAGG + Intergenic
901004801 1:6166495-6166517 CTGGGGCAACTCTGGCCAGAGGG + Intronic
902663233 1:17920062-17920084 ATGGGTGGACACAGGACAGAGGG - Intergenic
902777952 1:18686522-18686544 CTTGGTGAAGCCTGGGCAGCTGG - Intronic
903134292 1:21299221-21299243 GTGGGTGAGGGCTGGGCAGAGGG + Intronic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
904249017 1:29209465-29209487 CTGGGTGAAGACTGTGGAGTGGG + Intronic
904358248 1:29955277-29955299 ATGGGTGAGCACTCAGCAGAGGG + Intergenic
904437066 1:30505990-30506012 ATGGGTGAGCACTCAGCAGAGGG - Intergenic
904916970 1:33977218-33977240 CTGGGTGGGGAGTGGGCAGATGG + Intronic
905040052 1:34948218-34948240 CGGGGTGACGGCTGGGCAGAGGG - Intergenic
906209990 1:44007412-44007434 CTGGGGAACCCCTGGGCAGAGGG - Intronic
906838462 1:49109493-49109515 CTGAGTGGACACTGGGAGGAAGG - Intronic
908262160 1:62347567-62347589 CTGGCTGAGCTCTGGGGAGATGG + Intergenic
911104439 1:94118747-94118769 CTGGGAGCACACTGTGGAGAAGG + Intronic
912229255 1:107773610-107773632 CTTGGTGAACACTGAGAATAAGG + Intronic
913207609 1:116555413-116555435 CTGGGTGAGAACTGGGCATGGGG + Intronic
913445667 1:118948093-118948115 CTGAGTCACCACTGGGGAGATGG - Intronic
914918022 1:151830251-151830273 CTGGGTGGAGATTGGGCAGTAGG + Intronic
914947699 1:152080885-152080907 CCGGGTGCACACTGGGCATCTGG + Intergenic
915001458 1:152597634-152597656 CTGGGTGAAAGCTTGGCAGCTGG + Intronic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
915875800 1:159611049-159611071 CTGGATGAAATCTTGGCAGAAGG + Intergenic
915923889 1:160001654-160001676 TTGGGGGAACACTGGGAAGATGG - Intergenic
917265542 1:173217024-173217046 AGGGTTGAACACTGGGGAGAGGG - Intergenic
917697595 1:177542422-177542444 CAGGGTGGAGACTGGGAAGAGGG + Intergenic
918081591 1:181211842-181211864 CTGAGTCATCACTGGGCTGAAGG - Intergenic
919208332 1:194447132-194447154 ATGGCTGAAAACTGGGGAGAAGG - Intergenic
920154650 1:203938714-203938736 GTGGGAGAACACTGGGGAAAAGG + Intergenic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
923030669 1:230246878-230246900 CTAGATAGACACTGGGCAGAGGG + Intronic
923635403 1:235691519-235691541 GTGAGTGAACACTGAGAAGAAGG + Intronic
924097065 1:240563748-240563770 GTGGGTGAAAAATGGGGAGATGG - Intronic
1064128683 10:12688237-12688259 CTGGGTGAACACGTGGCTTATGG + Intronic
1065456716 10:25914074-25914096 GTGGCTGAACCCTGGGCACAGGG + Intergenic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065990093 10:31000606-31000628 CTGGGTGAACAGTGGGCTACAGG - Intronic
1066026545 10:31364127-31364149 CTGGGTGCACACTGGGCATCTGG + Intronic
1067419367 10:46133478-46133500 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067426631 10:46215919-46215941 CTGGGGGAACACAGCGCACAAGG + Intergenic
1067504718 10:46840075-46840097 CTGGGGGGACACAGGGCACAAGG - Intergenic
1070272966 10:74975886-74975908 CTGGAAGAACTCTGGGGAGAGGG - Exonic
1070567040 10:77611664-77611686 CTGGGTGAACACTGGCCTTGGGG - Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1071481568 10:86068935-86068957 CTTGCTGGACACTGGGCAGGGGG - Intronic
1072611694 10:97021337-97021359 CTGGGTGAAGACTGGCTACAAGG - Exonic
1072660880 10:97362828-97362850 CTCGGGCCACACTGGGCAGATGG + Intronic
1075438213 10:122460585-122460607 CTGGGTCCACACTGAGCAGATGG - Intergenic
1075896257 10:125997732-125997754 CTGCGTGTCCACTGGGCACAGGG - Intronic
1076369320 10:129941507-129941529 CTGGGTGAGCACTGGGCACTGGG + Intronic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076842740 10:133054224-133054246 CTGGGTCAATGATGGGCAGATGG + Intergenic
1076922432 10:133461295-133461317 CTGGGAGACCACAGGTCAGATGG - Intergenic
1077097324 11:804621-804643 CTGGGTCACCACTGGAAAGAGGG + Intronic
1077219168 11:1407869-1407891 CTGAGGGCACACTGGGCAAATGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078180899 11:9009099-9009121 CTGTGCGAAAACTGGTCAGACGG - Intergenic
1078927634 11:15888893-15888915 CTGGGAGAGCACTGAGCAAAAGG - Intergenic
1079382580 11:19951049-19951071 CTGTGTGAAGCCTGGGCATAAGG - Intronic
1081617723 11:44600453-44600475 CTGGGGGAACACTGGGGATGAGG + Intronic
1081940790 11:46939712-46939734 ATGGATGGAAACTGGGCAGATGG - Intronic
1083573350 11:63771702-63771724 CTGGGAGAACGCTGGGGAGAGGG + Intergenic
1083657681 11:64237529-64237551 CTGGGTGCAGCGTGGGCAGAGGG - Exonic
1084355113 11:68633347-68633369 CTGTGTGTTCACGGGGCAGAAGG + Intergenic
1084672816 11:70617409-70617431 CTGGGTGAACTCTGGCCTGGGGG - Intronic
1084751318 11:71205896-71205918 CTGGGGGGACACAGGGCTGAGGG - Intronic
1088044297 11:105428840-105428862 CTGAGTGAAGAAGGGGCAGATGG - Intergenic
1088511578 11:110580895-110580917 CTGGGTGTGCACATGGCAGATGG + Exonic
1088626981 11:111736525-111736547 CTGGGTGACCACTGTCCAGTTGG - Intronic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1090621299 11:128563301-128563323 CTGAGTCAACACTGGGTGGATGG + Intronic
1090958707 11:131536947-131536969 CAGGTGTAACACTGGGCAGAGGG - Intronic
1092295708 12:7198563-7198585 TTGTGTGAACTCTGGGTAGAGGG + Intronic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1095984622 12:47991185-47991207 CTGGCTGACCCCTGGGGAGAGGG - Intronic
1096247080 12:49997205-49997227 CTGGGATAAAACAGGGCAGAAGG + Intronic
1100981546 12:100166385-100166407 CTGGGTGAGCACGTGGCTGATGG + Intergenic
1101150920 12:101881627-101881649 CAGGGAGAACACCTGGCAGAGGG - Intronic
1104758530 12:131283462-131283484 CTCTGTCCACACTGGGCAGATGG - Intergenic
1104822163 12:131683529-131683551 CTCTGTCCACACTGGGCAGATGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1106300509 13:28460093-28460115 CTGGGTGATGGTTGGGCAGATGG - Intronic
1106305037 13:28501839-28501861 CTGGCTGACTGCTGGGCAGATGG - Intergenic
1109851829 13:68075642-68075664 CTGTGTCACCACTGGGCAGCTGG - Intergenic
1110626903 13:77662704-77662726 CCGGGTGCACACTGGGCATCTGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1113782896 13:112986712-112986734 GTGGGTGGACACTGGGCCGAGGG + Intronic
1114272953 14:21115109-21115131 GTGGGTGAGTACTGAGCAGAGGG - Intergenic
1115742006 14:36398492-36398514 CTGGGAGTCCACTGTGCAGAAGG - Intergenic
1117066244 14:52015265-52015287 CTGGGTGGGCTCTGAGCAGATGG + Exonic
1117324750 14:54658747-54658769 TTGGAGGAACACTGGGGAGATGG - Intronic
1117798448 14:59418792-59418814 CTGGGAGAACATTGGCCAGGAGG + Intergenic
1117868757 14:60175918-60175940 CTGGCAGAAAACTAGGCAGAGGG + Intergenic
1118253186 14:64182913-64182935 CGGGGTGACGGCTGGGCAGAGGG + Intronic
1118449845 14:65890314-65890336 TTGGGTGATCACTGAGAAGAGGG + Intergenic
1119835826 14:77747878-77747900 CGGGGTGGCCTCTGGGCAGAGGG - Intronic
1121560341 14:94870109-94870131 CTGGATCAACACTGGGGAGTGGG + Intergenic
1122116020 14:99527679-99527701 CTGGGTGGGCACTGGGCTGAGGG - Intronic
1122155704 14:99749163-99749185 CTGGGTGCACACCGGGAAGCGGG + Intronic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122918498 14:104869724-104869746 CTGCGTCCCCACTGGGCAGAAGG - Intronic
1123054439 14:105562370-105562392 CTGGGGGAGCCCTGGGCAGGTGG + Intergenic
1123079023 14:105682789-105682811 CTGGGGGAGCCCTGGGCAGGTGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124215994 15:27807408-27807430 CTGGGGACACACTGGGCAAAGGG - Intronic
1124375008 15:29124211-29124233 CAGGCTGGACACTGGGCTGAGGG + Intronic
1124432239 15:29617717-29617739 GTGGGTGGACATTGGGCAGGAGG + Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1124635579 15:31362714-31362736 CCAGGGGAACACTGAGCAGATGG - Intronic
1125529863 15:40406049-40406071 CTGGGTGGGCGCTGGGCCGATGG - Intronic
1126385577 15:48090048-48090070 GTGGGTGGACTCTGGGCAGGAGG - Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1128088682 15:64904318-64904340 CTGGCAGAGCCCTGGGCAGAGGG + Intronic
1128260845 15:66231910-66231932 GTGGGTGAACACTCAGCACAAGG - Intronic
1128346917 15:66859860-66859882 CAGGGTGGTCACTGGGCAGCAGG - Intergenic
1128780846 15:70357639-70357661 CTCGGACACCACTGGGCAGACGG + Intergenic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131588969 15:93727919-93727941 CTTGGGAAAAACTGGGCAGAGGG + Intergenic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1132937438 16:2488256-2488278 CTGGCTGAACACTGGTCAACTGG + Intronic
1133231707 16:4370031-4370053 GGGGGTGAACACCAGGCAGATGG + Intronic
1138132287 16:54490801-54490823 CAGGTTGCACACTGGGAAGAAGG - Intergenic
1138829563 16:60359780-60359802 CCGGGTGCACACTGGGCATCTGG + Intergenic
1141620078 16:85232604-85232626 CTGTGTGAGGACTGGGCAGGAGG + Intergenic
1141627722 16:85270124-85270146 CTGGGGTCACACTGGCCAGAAGG + Intergenic
1141685264 16:85566461-85566483 CTGGGTGAACCCTGGGCCCCAGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1143206039 17:5139653-5139675 CAGGCTGAACACTGCGGAGAGGG + Exonic
1143764519 17:9128767-9128789 TTGGGTGAACGCTGGCCAGGCGG - Intronic
1144486563 17:15670421-15670443 CTGGGAGAGCAATGGGCATAGGG - Intronic
1144785826 17:17831048-17831070 CTAGGTGAATGTTGGGCAGAAGG + Intronic
1144914457 17:18711869-18711891 CTGGGAGAGCAATGGGCATAGGG + Intronic
1145312378 17:21707706-21707728 CTGGGTGGAGAGTGGGCTGAAGG - Intergenic
1145397424 17:22506654-22506676 CTGGGGGGACACTGAGCACAGGG + Intergenic
1146935730 17:36811573-36811595 ATGGAAGGACACTGGGCAGAAGG - Intergenic
1147586276 17:41655504-41655526 CTGAGTGAGCACAGGGCAGCGGG - Intergenic
1147930151 17:43974454-43974476 CTGGGTGAACAATTGACACAGGG - Intronic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1148426873 17:47606385-47606407 CTGGGTCAAGACTGGTCAGGAGG - Intronic
1148551383 17:48552477-48552499 CTGGGTGAGGCCTGGGCAGTGGG + Exonic
1148581150 17:48744901-48744923 CTGGCTGAACTCTGGGTAGGGGG - Intergenic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152522235 17:80863251-80863273 CTGGGAGAATCCTGGACAGACGG - Intronic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1152940879 17:83172458-83172480 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940891 17:83172496-83172518 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940970 17:83172796-83172818 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1152941026 17:83172984-83173006 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941044 17:83173060-83173082 CTGGGTGAGCAGTGGGGTGAAGG + Intergenic
1152941077 17:83173173-83173195 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941131 17:83173363-83173385 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1157099998 18:44720739-44720761 GTGCTTGAACACTGTGCAGAGGG + Intronic
1157405280 18:47417595-47417617 CTGGGAGGACACTGGGCCCAGGG + Intergenic
1158009986 18:52717487-52717509 GTGGCTGAACACTGGGCTGGGGG - Intronic
1158440149 18:57468151-57468173 CAGGGTGGACACTGTGCAAATGG - Intronic
1159890689 18:73950569-73950591 CTGGGTCAACTCAGGTCAGAGGG - Intergenic
1160411092 18:78675949-78675971 CTGAGTGAACGGTGGGCAGGTGG - Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1160827807 19:1088859-1088881 CTGTGTGACCGCTGGGCACAAGG - Intronic
1161402971 19:4077078-4077100 CTTGGTAAAAACGGGGCAGAAGG - Intergenic
1161501358 19:4617846-4617868 CTGGGTGGGCAGTGGCCAGAGGG - Intergenic
1162380737 19:10330261-10330283 CTTGGAGAACACTGGGCATCGGG - Intronic
1162807450 19:13145358-13145380 CTGGGTGACTTCTGGGCAGCTGG + Exonic
1162900676 19:13793922-13793944 GTGGGTGAAGACTGGCCAGAGGG + Intergenic
1162925841 19:13930171-13930193 CCGGGTGGGCACTGGGCAGCGGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167233735 19:48301344-48301366 ATGGATGAATACTGGGTAGATGG + Intronic
1168128562 19:54301619-54301641 CTGTGTGAACGCTGTGCTGAAGG - Intergenic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925501512 2:4510127-4510149 CTGGCTGATCTCTCGGCAGAGGG - Intergenic
926281886 2:11455880-11455902 ATGGGAGTACACTGGGCATAGGG + Intronic
926315244 2:11704863-11704885 CTGGGTGAACACTGGACACTGGG + Intronic
927513236 2:23657728-23657750 CTGGGGGAGCACTGGGCCCAGGG - Intronic
927808479 2:26168950-26168972 CTGGGTCAACACTGGGCCTCTGG + Intergenic
928342826 2:30460247-30460269 GCAGATGAACACTGGGCAGATGG - Intronic
928595691 2:32856969-32856991 ATAGGTGGGCACTGGGCAGAGGG - Intergenic
929426782 2:41851851-41851873 GTGGGTGAGCAAGGGGCAGAGGG + Intergenic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
930186900 2:48420019-48420041 CTCGGTGAGCACAGGGCAGTGGG + Intergenic
930257441 2:49108531-49108553 CTGGCTGCAAACTAGGCAGAAGG + Intronic
930907579 2:56590709-56590731 TTGTGTTAACAATGGGCAGATGG + Intergenic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
932063463 2:68529542-68529564 CTGGGTGCACACTGGGCATCTGG + Intronic
932467420 2:71932723-71932745 CTTTGTTCACACTGGGCAGAGGG + Intergenic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
932793203 2:74673566-74673588 CTGGCTGAACGGTGGGGAGAGGG + Exonic
932962461 2:76429979-76430001 CTGGTTGCACACTGGGCAAGTGG + Intergenic
933099994 2:78243063-78243085 CTGGGTGGAGGCTGGGAAGAAGG - Intergenic
933307089 2:80614745-80614767 CTGGTTCAAAACTGGGGAGAGGG - Intronic
934981013 2:98841114-98841136 CTTTGTGAACACTGGGTAAAGGG - Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
937248458 2:120509211-120509233 CTGGGTGAGCAGTGTGCTGATGG + Intergenic
937615766 2:123920608-123920630 CTGGGTAAAAACATGGCAGAAGG + Intergenic
937796634 2:126030335-126030357 CTGGTGGAAAACTGGGCAGTGGG - Intergenic
937979763 2:127608024-127608046 CTGGGAGGACACTGAGCAGGGGG + Intronic
937986677 2:127641170-127641192 CAGGATTCACACTGGGCAGAGGG + Intronic
938598452 2:132812590-132812612 CTGTGGGAACTCTCGGCAGAGGG + Intronic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
940116381 2:150213072-150213094 CTGGCTGATTACTGGACAGAAGG - Intergenic
940812057 2:158255631-158255653 CTGAGTGAACAGTGAGCAAAAGG + Intronic
942727731 2:179027872-179027894 TTGGGTGAACAATGGGATGAGGG - Intronic
946216476 2:218187605-218187627 CTAGATGGAAACTGGGCAGATGG + Intergenic
948082642 2:235219265-235219287 GTGGATGAACACAGGGCAAAGGG - Intergenic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172230265 20:33331565-33331587 CTGGGTGCACTCTGAGCAGACGG - Intergenic
1172402255 20:34659517-34659539 CTGGGTGGTGGCTGGGCAGAGGG - Intronic
1172713194 20:36943092-36943114 TGGGGTGAACTCTGGGCACAGGG + Intronic
1172762730 20:37333497-37333519 CTGGATGATGACTGGACAGATGG + Intergenic
1172807710 20:37624477-37624499 CGGGCTGAAAACTGGGGAGATGG - Intergenic
1172954768 20:38748432-38748454 CTGGGCGGACACTGCGCCGAGGG + Exonic
1172989508 20:39022785-39022807 TTGAGTGAACACTGGAAAGACGG + Intronic
1174377969 20:50138928-50138950 CTGGGTGACCTCTGGGGAAATGG - Intronic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1174720719 20:52809206-52809228 CTGGAGGAGCACTGGCCAGAGGG + Intergenic
1175161848 20:57014018-57014040 CTGGGTGAACACCGGCCAGGCGG - Intergenic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1175723325 20:61300624-61300646 CAGGAGGAACACTGGACAGAGGG - Intronic
1176274373 20:64255537-64255559 CTGGCTGAGCACTGCGCGGACGG + Intergenic
1176335028 21:5588547-5588569 CTGGGTGAACCATGAACAGAAGG - Intergenic
1176392729 21:6232401-6232423 CTGGGTGAACCATGAACAGAAGG + Intergenic
1176468690 21:7083773-7083795 CTGGGTGAACCATGAACAGAAGG - Intronic
1176492251 21:7465551-7465573 CTGGGTGAACCATGAACAGAAGG - Intergenic
1176508391 21:7672832-7672854 CTGGGTGAACCATGAACAGAAGG + Intergenic
1178204432 21:30447064-30447086 CTGGGGGAACCCTGAGTAGAGGG - Intergenic
1178301850 21:31459725-31459747 CTGGGAGAAGCCTGGCCAGAGGG + Intronic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1179088606 21:38242756-38242778 CTGGGGGAACACAGAGCAGGTGG - Intronic
1179450887 21:41467567-41467589 ATGGGTGGACACTGGGGGGATGG + Intronic
1179591028 21:42408106-42408128 CTGGGTGAACCCTGGAAAGGGGG + Intronic
1179769421 21:43603336-43603358 CTGGGTGACCAGTGGCCGGAGGG + Intronic
1180044539 21:45298735-45298757 CTGGGTGGAGACTGGGAAGCAGG + Intergenic
1180940951 22:19659235-19659257 CTGGGTGAACACTGTGCCCCAGG + Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181615429 22:24051096-24051118 CTGGGTGCACAGTGGCCAAATGG + Intronic
1182114155 22:27745402-27745424 CTGGGGGAACGAGGGGCAGAAGG - Intergenic
1182315476 22:29444077-29444099 CTGGGAGAACTGTGAGCAGAAGG + Intergenic
1183671553 22:39275943-39275965 CTGGGGAGAAACTGGGCAGATGG - Intergenic
1184505801 22:44901290-44901312 CTGGGAGAACACTGGGAATGTGG + Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1184927233 22:47651434-47651456 CTGGGTGAGAAATGTGCAGATGG + Intergenic
949149482 3:748000-748022 CAGGGTGGAAACTGAGCAGATGG + Intergenic
949377138 3:3403173-3403195 CTGGCTTAAAAATGGGCAGAGGG + Intergenic
949858731 3:8486118-8486140 CTTGGTGAACTCAGGGCAAAGGG + Intergenic
950140531 3:10612100-10612122 CTGGCTCAGCACTGGGCACACGG + Intronic
950504008 3:13382458-13382480 CTGGGTGCACAGTGGTCAGCAGG - Intronic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
954229929 3:49209017-49209039 CTGGTTGAATTCTGGGAAGATGG + Intronic
956602818 3:71041016-71041038 CGGAGTGAGCACTTGGCAGAAGG + Intronic
962939953 3:140116753-140116775 CTGGTTGAACACTGAGCAGAAGG - Intronic
966883820 3:184363621-184363643 CTGGGTGGACACGGGGCCCAGGG - Intronic
969180141 4:5434108-5434130 CTGGGCGGACACTGGGCACCAGG - Intronic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
973650477 4:52992861-52992883 CGGGGTGACTGCTGGGCAGAGGG - Intronic
975320429 4:73004316-73004338 GTGGGAGAAGACTGGGGAGAAGG - Intergenic
976200133 4:82569877-82569899 CAGGGTAAAGACTGGGCAGTTGG - Intergenic
978245755 4:106570589-106570611 ATGGTTGAACCTTGGGCAGAAGG + Intergenic
978619853 4:110627342-110627364 CTGGGGGAACAGTGTTCAGATGG + Intronic
981720957 4:147800596-147800618 CTGGGTGACCACTTTGCATAGGG + Intronic
983566263 4:169155526-169155548 GTGGATGAAAACTGGGCTGAAGG - Exonic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
986434867 5:7719628-7719650 CTGGGGAAAGACTGAGCAGATGG - Intronic
991300086 5:65121539-65121561 CTGGGTCCTCACTTGGCAGAAGG + Intergenic
991533156 5:67637571-67637593 CTGGGTGTGCCCTGGGGAGATGG + Intergenic
993110536 5:83651777-83651799 GAGGGTGGACATTGGGCAGAGGG + Intronic
994681169 5:102889248-102889270 CTGGCAGAAGACTGGGCAGCAGG + Intronic
998641059 5:144011799-144011821 CTGGGTGGACTCAGAGCAGATGG + Intergenic
998814963 5:146004085-146004107 GTGGATGAGAACTGGGCAGAAGG + Exonic
999373124 5:151068284-151068306 CTGGATGACCACTGGGCAGACGG + Intronic
999950129 5:156640067-156640089 CTGATGGAACACTGAGCAGAGGG - Intronic
1001605247 5:172955046-172955068 GTGGGTGAAACCTGGGAAGAGGG + Intergenic
1001929414 5:175662164-175662186 CAGGGTGAAGACTGCCCAGAGGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1003627284 6:7753524-7753546 CTGGGTTACCGCTGTGCAGAAGG - Intronic
1004007067 6:11646747-11646769 CTGGGTGAAAATGGGGAAGAGGG + Intergenic
1005243081 6:23854112-23854134 CCGGGTGCACACTGGGCATCTGG - Intergenic
1005340525 6:24839699-24839721 TGGGGTGAGCACTAGGCAGAGGG - Intronic
1006442207 6:34059716-34059738 GTGTGTGAGCACTGGGCAGCTGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1009398761 6:63230414-63230436 CCGGGTGCACACTGGGCATCTGG + Intergenic
1010524150 6:76879959-76879981 CTGGGCGAACTCTAGGTAGAAGG + Intergenic
1011731494 6:90269030-90269052 CTGGCTGAACTCTGGGTAGCTGG - Intronic
1013942351 6:115680037-115680059 CAGAGTGAACTCTGAGCAGATGG - Intergenic
1017161122 6:151366810-151366832 CTTGATGTACACTGGGAAGATGG - Exonic
1019645019 7:2124430-2124452 CTGGGAGATGAGTGGGCAGAAGG + Intronic
1019685942 7:2382256-2382278 CCGGGTCAACACTGTGCAGCAGG - Intergenic
1021170141 7:17389773-17389795 TTGGGTGAACCCTGGGGAGGAGG + Intergenic
1022251199 7:28610224-28610246 CTGGGTGAACAGTGGGGAGCTGG + Intronic
1024962733 7:54994581-54994603 CTGGGAGAGCCCTGGGCAAATGG - Intergenic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1036586770 8:10131715-10131737 CAGGGTGGACACTGGCCATAGGG - Intronic
1037329238 8:17727356-17727378 CCGAGGGAACACTGGGCAGGTGG - Intronic
1038373144 8:27012449-27012471 CCGGGTGCACACTGGGCATCTGG + Intergenic
1038404177 8:27309597-27309619 TTGGGAGAACACTGGGTAGCTGG - Intronic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1040988447 8:53322296-53322318 CCGGGTGCTCACTGGGCAAAAGG - Intergenic
1041256666 8:55984679-55984701 CTGTGTGACCACTGGGCTGGGGG - Intronic
1042229402 8:66541420-66541442 CTGGGTGAAAGCTCAGCAGAGGG - Intergenic
1043199939 8:77354315-77354337 CTGGTGAGACACTGGGCAGAGGG + Intergenic
1044872254 8:96630931-96630953 CAGGGCCAACACTGGGCAGGAGG - Intergenic
1046789701 8:118307859-118307881 CTGGGAGAAGACTGGAAAGAAGG + Intronic
1048154365 8:131930204-131930226 CTGGATGGACATTGTGCAGATGG + Intronic
1049365980 8:142237106-142237128 CTGGGGAAGAACTGGGCAGAGGG - Intronic
1050471464 9:5995605-5995627 CTGGGAGATCTCTGGGAAGAGGG - Intronic
1050984586 9:12066387-12066409 CTGGATGATGACTGGGGAGAAGG - Intergenic
1052413196 9:28147886-28147908 CCGGGTGCACACTGGGCATCTGG - Intronic
1052567648 9:30178002-30178024 CTGAGTGCACACTGGGCATGAGG - Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055712403 9:79077445-79077467 CAGGAAGAACACTGGGCTGAGGG - Intergenic
1056020416 9:82433208-82433230 CCGGGTGCACACTGGGCATCTGG + Intergenic
1056638814 9:88352744-88352766 CTGTGTAAAAACTGGTCAGAAGG + Intergenic
1056690708 9:88806612-88806634 CTGGGTGGAGGCTGAGCAGATGG - Intergenic
1057071481 9:92104100-92104122 CCGGGTGCACACTGGGCATCTGG - Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1061791182 9:133059973-133059995 CTGAGTGCACCCTGGGGAGATGG - Intergenic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1062416238 9:136451729-136451751 CTGAGGGAAGACTGGCCAGAGGG + Intronic
1203793205 EBV:162465-162487 CTGGGTGAAGATGGGGCAGGCGG + Intergenic
1203426612 Un_GL000195v1:46369-46391 CTGGGTGAACCATGAACAGAAGG + Intergenic
1187048715 X:15675284-15675306 CTGGATGATCACTGGGCGAAGGG + Intergenic
1188371589 X:29376306-29376328 CTGGGTGAACACTGAAATGAAGG - Intronic
1188987060 X:36777428-36777450 CTGGGGGAAGACTTGGCAGGAGG - Intergenic
1190059132 X:47199637-47199659 CTCTGAGAAAACTGGGCAGAAGG - Intronic
1193206491 X:78754346-78754368 CTGGAGGGACTCTGGGCAGAAGG + Intronic
1194682825 X:96874419-96874441 TTTGGTGAACAATGGGCATATGG - Intronic
1195663719 X:107408599-107408621 CTGGGTGTACACTAGGTAGTGGG + Intergenic
1195696946 X:107674382-107674404 CTGGGGGACCATTTGGCAGAAGG - Intergenic
1198502392 X:137264406-137264428 CAGGGTGTAGACTGTGCAGACGG + Intergenic
1199967572 X:152832584-152832606 CAGGGGCAAAACTGGGCAGAGGG - Intronic
1201414268 Y:13731968-13731990 CTGGGAAAATTCTGGGCAGATGG - Intergenic