ID: 1184851604

View in Genome Browser
Species Human (GRCh38)
Location 22:47124473-47124495
Sequence GCCTCTTCTTGACCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184851600_1184851604 -2 Left 1184851600 22:47124452-47124474 CCTGGGACGCATTGGGACCTTGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215
1184851594_1184851604 17 Left 1184851594 22:47124433-47124455 CCAGCCTAGGGGCGCATGTCCTG No data
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215
1184851588_1184851604 30 Left 1184851588 22:47124420-47124442 CCAGGCCCTCGAGCCAGCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215
1184851597_1184851604 13 Left 1184851597 22:47124437-47124459 CCTAGGGGCGCATGTCCTGGGAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215
1184851592_1184851604 25 Left 1184851592 22:47124425-47124447 CCCTCGAGCCAGCCTAGGGGCGC 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215
1184851593_1184851604 24 Left 1184851593 22:47124426-47124448 CCTCGAGCCAGCCTAGGGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184851604 Original CRISPR GCCTCTTCTTGACCTGGGCC TGG Intronic
900177900 1:1298835-1298857 GCCACTTCTTGACCTGAGCAAGG + Intronic
900372018 1:2336399-2336421 GCCTCCTCATCAGCTGGGCCAGG - Intronic
902950971 1:19882603-19882625 GCCGCTCCTTGGCCAGGGCCCGG - Exonic
904206169 1:28856680-28856702 GCCCCTTCTGCACCAGGGCCTGG - Intronic
904448121 1:30591007-30591029 GCCTCTTCTTGATTTGGAGCAGG + Intergenic
905015731 1:34777209-34777231 ACCTCTTCTGGCCCTGGCCCTGG - Intronic
905042585 1:34972642-34972664 CCCAGTTCTTGACCTTGGCCAGG - Intergenic
905267010 1:36761254-36761276 GCCACTCCTTAACCTGGGTCAGG - Intergenic
905692789 1:39955370-39955392 CCCTCACCTTCACCTGGGCCGGG - Exonic
906560924 1:46756238-46756260 GCCTCTGCTTCACCTGGGCCTGG + Intergenic
906667443 1:47631802-47631824 GCCCATTCCTGTCCTGGGCCAGG + Intergenic
911821923 1:102434583-102434605 GTCTCTTTCTGACCTTGGCCCGG + Intergenic
912948168 1:114101962-114101984 CCCTCTTTTTGACCTGGGTTTGG - Intronic
915118185 1:153613128-153613150 GCTCCTTCTTGACTTGGCCCTGG + Intronic
915557657 1:156669387-156669409 GGCTCCTGTTCACCTGGGCCAGG - Exonic
916039806 1:160952236-160952258 GCATTTTCTTGTACTGGGCCAGG - Intronic
916497081 1:165356069-165356091 GCCCCTTCTCGACCTGGGGCAGG - Intronic
920002067 1:202807454-202807476 CCCCCTTCTTGACCCCGGCCCGG + Intronic
920251620 1:204625924-204625946 GCATCCTCATGGCCTGGGCCTGG + Intronic
920373146 1:205492227-205492249 TCCTCTTCCTGACATGGGCTGGG - Intergenic
921183772 1:212652720-212652742 GCCTCTGCTGGGCCTGGGCAAGG + Intergenic
924809712 1:247390222-247390244 TCCTCTTCTTAACCTGGGGAGGG + Intergenic
1063200080 10:3779547-3779569 GCCTCTTCATGTGCAGGGCCAGG + Exonic
1067594133 10:47540557-47540579 TCCTCTTCCTGCCTTGGGCCTGG - Intronic
1067641243 10:48048672-48048694 TCCTCTTCCTGCCTTGGGCCTGG - Intergenic
1069755024 10:70769191-70769213 GCCTCTGCCTGGCCTGCGCCAGG - Intergenic
1069837341 10:71317841-71317863 GCCCCTTCCTCTCCTGGGCCGGG + Intergenic
1070567489 10:77614854-77614876 TCCTCTTCATAACCTGGCCCAGG + Intronic
1072626414 10:97115220-97115242 GGCTCTGCTTGACCTCGCCCAGG + Intronic
1073294802 10:102432485-102432507 GACTCTCCTAGCCCTGGGCCGGG + Intronic
1075040573 10:119104242-119104264 GCCTCTGCTCCACCTCGGCCCGG + Intronic
1075515526 10:123104995-123105017 GCCTCTTCTTGCCATTGGCAGGG + Intergenic
1075624317 10:123950842-123950864 CCCTCTCCTTGTCCAGGGCCAGG - Intergenic
1075811362 10:125227210-125227232 GCCACTTCTTGACGCTGGCCTGG + Intergenic
1076924613 10:133476055-133476077 GCCTCTCCTTGCCCTGGGCTGGG + Intergenic
1078088686 11:8250599-8250621 GCATCTTCTTGGCAGGGGCCAGG - Intronic
1078532193 11:12145334-12145356 GCATCTTCTAGGCCGGGGCCTGG + Intronic
1079203090 11:18392048-18392070 GCCTCTTCTGAGCCTGGGACTGG + Intergenic
1083579982 11:63818643-63818665 GCCTCCCCTTCACCTGGGTCAGG - Exonic
1084267174 11:68010980-68011002 GCCTCTTTGTGACCCGGGGCTGG + Intronic
1084323602 11:68386742-68386764 GCCTGTGCTTGGCCTGGCCCTGG - Intronic
1084334565 11:68449059-68449081 GACTCATCCTGACCTCGGCCGGG + Exonic
1084692109 11:70733683-70733705 CCCTCTCCATGACCTAGGCCAGG - Intronic
1089778640 11:120857216-120857238 GCCTGTTCATCGCCTGGGCCAGG - Intronic
1089844291 11:121446337-121446359 GCCACTTCTTGACCTCTTCCTGG - Intergenic
1090828749 11:130406169-130406191 GCATCATCGTGACCTGGGCTGGG - Intronic
1096113265 12:49041108-49041130 GCCTCATCTCGTCCTGGGGCTGG - Exonic
1096216657 12:49801510-49801532 GCCTCTTCTTGGCCGGGCACAGG - Intronic
1096611787 12:52806851-52806873 GCTACTTCTTGATTTGGGCCTGG - Exonic
1096994764 12:55831589-55831611 CCCTCTTTCTGCCCTGGGCCTGG + Intergenic
1097277886 12:57825569-57825591 GCCTAGTCCTGACCGGGGCCTGG + Intronic
1098663648 12:73131880-73131902 GCCTCTTCTTGTCCTTGGGCTGG + Intergenic
1101879673 12:108617639-108617661 TCCTCTTCATGACCTGGGGCAGG + Intergenic
1103005370 12:117416487-117416509 GGCTCTTCTTGGCCTGGTCTTGG - Intronic
1104675080 12:130707067-130707089 TCCTGTTCTTGAGCAGGGCCCGG + Intronic
1105212039 13:18262596-18262618 GCCTGTGCTTGACCTGGGTCAGG - Intergenic
1107332108 13:39312201-39312223 GCCTCTTGTGGACCTGGCCATGG - Intergenic
1107717647 13:43216648-43216670 GCCTCTCCTTGATCTGGGGAAGG - Intronic
1114150409 14:20032071-20032093 GCCTTTTCCTGACTTTGGCCTGG + Intergenic
1117993760 14:61459504-61459526 GGCTCTTCATGGCCTGGCCCTGG - Intronic
1118855545 14:69619129-69619151 CCCTCTTCTGGGCCTGGTCCCGG + Intronic
1119225737 14:72943446-72943468 GCTTCTTCCTGAACTGGGGCAGG + Intronic
1121959979 14:98250512-98250534 ACCTCTTCCAGACCTGGTCCAGG + Intergenic
1122283793 14:100639183-100639205 GCTCCTGCCTGACCTGGGCCTGG + Intergenic
1122694042 14:103544293-103544315 GCCTCCTCCTGGCCTGGGCCAGG - Intergenic
1122810618 14:104285956-104285978 GCCTCTCCTTGTCCTGCTCCTGG - Intergenic
1123666256 15:22611220-22611242 GATTGTTTTTGACCTGGGCCTGG + Intergenic
1124320077 15:28705626-28705648 GATTGTTTTTGACCTGGGCCTGG + Exonic
1124482435 15:30089791-30089813 GATTGTTTTTGACCTGGGCCTGG - Exonic
1124488894 15:30141893-30141915 GATTCTTTTTGACCTGGGCCTGG - Exonic
1124543978 15:30610857-30610879 GATTCTTTTTGACCTGGGCCTGG - Exonic
1124754636 15:32396430-32396452 GATTCTTTTTGACCTGGGCCTGG + Exonic
1125679632 15:41522776-41522798 GCCCCTTGTGGATCTGGGCCAGG + Exonic
1132240298 15:100252642-100252664 GCCCCAACCTGACCTGGGCCTGG + Intronic
1132398703 15:101491559-101491581 GCCTCTGCCTGACATGGCCCTGG + Intronic
1133008792 16:2898766-2898788 GCCTCTGCTGGACCTGGGGTGGG - Intronic
1134039662 16:11058863-11058885 GCGTCTCCTTGACTTGGACCTGG + Intronic
1134063534 16:11212850-11212872 GCATTTTCCTGGCCTGGGCCAGG + Intergenic
1135403380 16:22181515-22181537 GCCTCTTCTTGATGTGGCCCTGG - Exonic
1136673856 16:31881331-31881353 GCCTCTTCTGAGCCTGGTCCAGG + Intronic
1138190863 16:55012956-55012978 GCATCTTCTTCCACTGGGCCCGG + Intergenic
1139435774 16:66935689-66935711 GCTGCTTCTTGTCCGGGGCCAGG + Exonic
1139439751 16:66960242-66960264 GCCTGCTCTTGACCGGGGCGGGG - Intergenic
1140392854 16:74602967-74602989 GCCTCTTCATCACCTTGGCCAGG - Intronic
1141647471 16:85375392-85375414 GCCTCATCTTCACCAGGCCCAGG + Intergenic
1141659637 16:85435130-85435152 GCCTCTGCCTGACCTGGACAGGG - Intergenic
1142069919 16:88086465-88086487 GCCCCTTCTTCAGCCGGGCCAGG + Intronic
1143163860 17:4887825-4887847 GCCTCCTCCTGACCTGCCCCGGG + Intronic
1147359732 17:39923194-39923216 GCCTCGCCTTGCCCTGGTCCGGG + Exonic
1147373616 17:40011044-40011066 GCCTCTCATTGCCCGGGGCCTGG - Intergenic
1148623093 17:49049378-49049400 GCTGCTGCTTAACCTGGGCCAGG - Exonic
1150133156 17:62680087-62680109 GCCTCTTGTTCACCTGTTCCGGG + Intronic
1150492648 17:65585008-65585030 GCTTCCTCTTCAGCTGGGCCAGG - Intronic
1151724542 17:75876614-75876636 GCCTGTCCTGGATCTGGGCCAGG + Intronic
1151756872 17:76080200-76080222 GCCCCTTCTTGGACGGGGCCGGG - Intronic
1152153577 17:78618097-78618119 ACCTCTTCCTGCCCTGGGCAAGG - Intergenic
1152155532 17:78630201-78630223 GCCTCGGCCTGACCTGGGGCAGG - Intergenic
1152342565 17:79733430-79733452 GCCTCTTCCAGCCCTGGGTCCGG + Intronic
1152480188 17:80545653-80545675 GCCTCTTCTGGGCCTGGGGGAGG + Exonic
1152627979 17:81396950-81396972 GCCTCTCCTGGAGCTGGGCTGGG + Intronic
1153423462 18:4935592-4935614 AACTCTTCTTGACATTGGCCTGG - Intergenic
1156399210 18:36725496-36725518 GCCTCTTCTGTACCTGTGCAGGG + Intronic
1157329206 18:46690963-46690985 GCCTCTCACTGACCTGGTCCAGG + Intronic
1160838661 19:1136570-1136592 GGCTCTTCTTGGCCTTGGCTGGG + Intronic
1160903871 19:1443002-1443024 CCCTCTCCTTGAGCTGGACCTGG - Intergenic
1162302055 19:9849798-9849820 GCTTCCCCTTGCCCTGGGCCAGG + Intergenic
1163266206 19:16224038-16224060 GTGTCTCCGTGACCTGGGCCAGG + Intronic
1163299421 19:16434364-16434386 GCCTCTTGATGTCCTGGGCAGGG - Exonic
1163693722 19:18751660-18751682 TCCTCTTCTTGCTCTGGGGCTGG + Intronic
1165065119 19:33224341-33224363 GCCTGGTCCTGACCTGGCCCTGG - Intronic
1166856630 19:45785606-45785628 GCCTCATCTGCACCTGGGCCCGG - Exonic
925727661 2:6889217-6889239 GCCTCTCCTTACCCTGAGCCTGG + Intronic
925909773 2:8566069-8566091 GTCTCTTCTAGGCCTGGGTCAGG - Intergenic
926231707 2:11009198-11009220 GAATGTTCTTGAGCTGGGCCTGG + Intergenic
927207810 2:20621116-20621138 GCGGCTTCTTGCCCTGGGGCAGG + Intronic
927722870 2:25397987-25398009 CCCTCTGCATGATCTGGGCCAGG + Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
933870204 2:86558640-86558662 GCCTCTGCTTATCCTGTGCCAGG + Intronic
934301587 2:91779812-91779834 GCCTGTGCTTGACCTGGGTCAGG + Intergenic
934514490 2:94977719-94977741 GCCTCTTCCCAACCTGGGCCAGG + Intergenic
940744536 2:157553070-157553092 GCGTATTCTTGACCTGGTCAGGG - Intronic
946332285 2:219017287-219017309 GCCTCTGCTTTACCTGGCCCTGG - Intronic
948589278 2:239038970-239038992 GCCTCTTCCTGGGCTGAGCCGGG - Intergenic
948993075 2:241564466-241564488 GCCTCAGCCTGGCCTGGGCCCGG - Intronic
1168972334 20:1939136-1939158 ACATCTGCTTGCCCTGGGCCCGG - Exonic
1170397050 20:15937499-15937521 GCCTCTTCTGAAGCAGGGCCGGG - Exonic
1171426115 20:25049765-25049787 GCCTCTGTGTGACCTTGGCCAGG - Intronic
1174296136 20:49546385-49546407 GCCTCCTCTGAACCTTGGCCTGG - Intronic
1174963687 20:55186239-55186261 CCCTCTGCCTGCCCTGGGCCAGG - Intergenic
1175069585 20:56322030-56322052 CCCTCTTCTCTACCTGGGCTGGG - Intergenic
1175223764 20:57433117-57433139 GCCTCGCCTTGAGCTGGGCCAGG + Intergenic
1175496309 20:59416876-59416898 GCCTCCTCTAGAACTGGGCAAGG - Intergenic
1179103628 21:38378592-38378614 GCCCCTACTTGACATGGTCCTGG + Intergenic
1179988426 21:44933325-44933347 GCCACATTTTCACCTGGGCCTGG - Intronic
1181014611 22:20061901-20061923 GCCTCCCCTGGGCCTGGGCCTGG - Intronic
1181033242 22:20158131-20158153 GCCCCTTTCTGACCTGGGCTGGG + Intergenic
1181100693 22:20536971-20536993 GCCTCTCCTGGACCTCAGCCAGG + Intronic
1181201038 22:21217246-21217268 GCCTGTGCTTGACCTGGGTCAGG - Intronic
1181510063 22:23385101-23385123 GCCCCTTTCTGACCTGGGCTGGG - Intergenic
1181803078 22:25359782-25359804 CCCTCTGCTTGGCCTGGCCCTGG + Intronic
1182034881 22:27190194-27190216 GCCTCTTCTCTGCCTTGGCCTGG + Intergenic
1183932100 22:41241034-41241056 GCCCCTTCTTCACCTCAGCCTGG - Intergenic
1183979105 22:41529420-41529442 GCCTCTTCTTTGCCTGTGCTGGG - Intronic
1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG + Intronic
1185203284 22:49521634-49521656 GCCTCTTCTGGACATGGGCACGG + Intronic
1203225880 22_KI270731v1_random:78182-78204 GCCTGTGCTTGACCTGGGTCAGG + Intergenic
1203264947 22_KI270734v1_random:8601-8623 GCCTGTGCTTGACCTGGGTCAGG - Intergenic
949337424 3:2991253-2991275 TCCTCTTTTTGTACTGGGCCAGG - Intronic
949881429 3:8664024-8664046 ACCTCGTGTTGACATGGGCCGGG - Intronic
954830943 3:53420863-53420885 GCAACTTCTGAACCTGGGCCAGG - Intergenic
955743105 3:62113115-62113137 GCCTCATCCTGACCTGGGTAAGG - Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
957217080 3:77334486-77334508 GCTTCATCTTATCCTGGGCCTGG - Intronic
961340744 3:126215821-126215843 GCTTGTTCTTGGCCTTGGCCAGG + Intergenic
961449136 3:126994651-126994673 GCCTCTACTTGGCCTGGCCCGGG + Intronic
961644429 3:128385056-128385078 GCCACTCCTTGTCCTGGGCCAGG - Intronic
962714624 3:138115645-138115667 ACCTCTTCTTGAGGTGGGGCGGG - Intronic
962809629 3:138949524-138949546 TCCTCTTCTTCACCAGGGCTGGG - Exonic
963910401 3:150812479-150812501 GGCTCATCTTGACTTTGGCCTGG + Intergenic
963912144 3:150823935-150823957 GCATCATCTTGATTTGGGCCTGG + Intergenic
967825126 3:193871398-193871420 GCCTCCTCTTGACCAGAGCATGG + Intergenic
977563852 4:98561799-98561821 GCTTCCTCTTCACCAGGGCCTGG - Intronic
982519694 4:156398745-156398767 GCCTCTTCTTCACCACTGCCAGG - Intergenic
985713748 5:1444817-1444839 GCCGCTTCTTGTTCTGGGCGCGG - Intronic
986241181 5:5961352-5961374 GCTTCTCCTTGACCTGGGACTGG - Intergenic
992732836 5:79689884-79689906 GCCTCTCCCGGGCCTGGGCCGGG - Exonic
994841331 5:104928931-104928953 GCCTCTTCCTGGGCTGGCCCAGG + Intergenic
997279351 5:132629324-132629346 GTCTGTTTTTGACCTGGGCCTGG + Intronic
997964293 5:138345413-138345435 GCCGCTTCTTGCCCTCTGCCCGG + Exonic
998381544 5:141729530-141729552 CCCTCTTCCTGACCAGAGCCAGG - Intergenic
999080454 5:148838527-148838549 GACTATTCTTGGCCTGGGCAAGG + Intergenic
999652576 5:153781934-153781956 TCGTCTTCTTTACCTGGCCCTGG - Intronic
1000804416 5:165771422-165771444 TCATCTTCTTGACCAGTGCCAGG + Intergenic
1001206454 5:169768106-169768128 GGCTCTTAATGACCTTGGCCTGG + Intronic
1001313054 5:170624836-170624858 TCCTCCTCCTGCCCTGGGCCAGG - Intronic
1002074945 5:176702926-176702948 GCCTTTTCTTGCCAAGGGCCTGG + Intergenic
1003093110 6:3120697-3120719 GGCTTTTCTTGACCTGACCCAGG - Intronic
1003845429 6:10169057-10169079 TCCTCTCCTTTACCTGTGCCTGG - Intronic
1005299144 6:24454050-24454072 GCCACCTGTTGACCTGGACCTGG - Exonic
1006313647 6:33278085-33278107 GCCTCTTCTGTACTTGGGCCGGG + Exonic
1006850397 6:37093821-37093843 GGCTCTTCCTGCCCTTGGCCTGG - Intergenic
1007091932 6:39190159-39190181 GCCACTGCTTGACCTGAGACAGG + Exonic
1007407636 6:41644103-41644125 GCCTCTCCTAGCCCTGAGCCCGG - Intronic
1011517156 6:88166662-88166684 GCCCCTTCTTGGCCTGGTCAGGG - Intergenic
1013575764 6:111482783-111482805 GCACCTTCTTGACAGGGGCCTGG + Exonic
1017159634 6:151352583-151352605 GCCTCCTCTTGACCTAGGCAGGG - Exonic
1019290372 7:247295-247317 GGCCCCTCTGGACCTGGGCCAGG - Intronic
1019545170 7:1570617-1570639 CCCCCTTCTTGGCCTTGGCCGGG - Intronic
1020000764 7:4754297-4754319 GCCGCTGCGTGACCTTGGCCGGG + Intronic
1020395861 7:7716961-7716983 ACCTCTTCTTGCCCTGAACCCGG + Intronic
1020895915 7:13939725-13939747 GTCACTTCTGGACCTGCGCCTGG - Intronic
1022612479 7:31890899-31890921 GCATCTTCTTGGTCTGGGACAGG + Intronic
1022980095 7:35596201-35596223 GTCTCCTCTTGTTCTGGGCCTGG - Intergenic
1023492588 7:40760178-40760200 TCCTCTTGCTGACCTGGGGCTGG + Intronic
1023913223 7:44569776-44569798 GGCTCTTGTGGTCCTGGGCCAGG - Intronic
1026943703 7:74303171-74303193 CCCTCTTCTTGCCCTGGTCAGGG + Intronic
1027238856 7:76314325-76314347 GCCTGATCTTGACTTGAGCCCGG - Intergenic
1028096661 7:86769256-86769278 GTCTTTTCTTGAACTGAGCCGGG + Intronic
1028273718 7:88824614-88824636 ACCACTTCTTGACCTGTTCCTGG + Intronic
1029315304 7:99707043-99707065 GTGTCTTCTTGACCTAGTCCAGG - Intronic
1030302906 7:107992203-107992225 GACTGCACTTGACCTGGGCCAGG - Intronic
1031093364 7:117389605-117389627 GCCTCATCCTGACTTTGGCCTGG - Intronic
1032078961 7:128849221-128849243 TCCTCTTCTTGGTGTGGGCCAGG + Intronic
1032780893 7:135164666-135164688 GCCTCGGGTTGGCCTGGGCCTGG + Exonic
1033280206 7:140001094-140001116 GCCTCCCCTTGACCTTGGCCTGG - Intronic
1033546813 7:142408635-142408657 GCCTCTTCTTGACCTCTCACTGG + Intergenic
1033602150 7:142896249-142896271 GCATCTTCCTGAACTGGGGCAGG - Intergenic
1034388857 7:150766291-150766313 GCCTCTTATTGGGCTGGGCGCGG - Intergenic
1034562776 7:151892096-151892118 GCCTCTGCTTTACTTGAGCCTGG - Intergenic
1036280131 8:7393380-7393402 GCCACCTCCTGGCCTGGGCCTGG - Intergenic
1036341392 8:7918503-7918525 GCCACCTCCTGGCCTGGGCCTGG + Intergenic
1038272062 8:26083159-26083181 GCTGCTCCTAGACCTGGGCCAGG - Intergenic
1040379207 8:46856081-46856103 CCCTCTTTTTGGCCTGGCCCCGG - Intergenic
1040850975 8:51899687-51899709 GCGTCTTGCTGACCCGGGCCGGG + Intergenic
1048868567 8:138778739-138778761 GCCTCCCCATGACCTGGGTCTGG + Intronic
1048991871 8:139765279-139765301 GGGTCTTCTTGACCTCAGCCTGG - Intronic
1049668302 8:143858631-143858653 GCGTCTTAGTGCCCTGGGCCAGG + Exonic
1049668718 8:143860230-143860252 GCGTCTTAGTGCCCTGGGCCAGG + Exonic
1049669133 8:143861832-143861854 GCGTCTTAGTGCCCTGGGCCAGG + Exonic
1049669548 8:143863434-143863456 GCGTCTTAGTGCCCTGGGCCAGG + Exonic
1049669958 8:143865027-143865049 GCGTCTTAGTGCCCTGGGCCAGG + Exonic
1049673039 8:143878159-143878181 GCCTCCTCTTCACCGGCGCCCGG + Intronic
1050651421 9:7780944-7780966 GCCTCTTCTTAAGATGGGGCAGG + Intergenic
1054724687 9:68638760-68638782 TCCACTTCTTGACATTGGCCTGG + Intergenic
1056304564 9:85277197-85277219 GCCTCTGCTTGACATGTGCATGG - Intergenic
1056573183 9:87834218-87834240 GCCTCTTCTAGACCAAGGCCAGG + Intergenic
1056775941 9:89512626-89512648 GCTTCTCCTTCCCCTGGGCCGGG + Intergenic
1060787275 9:126460607-126460629 GCCTCTCCCTGACCGGGGTCTGG + Intronic
1061207640 9:129174000-129174022 GCCCCTCCTCGACGTGGGCCTGG + Intergenic
1062059418 9:134486888-134486910 GCCTCTTCCTGGCCAGGACCAGG + Intergenic
1062227922 9:135464270-135464292 GCATCATCTTGACCTTGGTCTGG - Intergenic
1203761441 EBV:14493-14515 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203762370 EBV:17565-17587 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203763299 EBV:20637-20659 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203764228 EBV:23709-23731 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203765157 EBV:26781-26803 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203766086 EBV:29853-29875 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1203767015 EBV:32925-32947 CCCTCGTCTTGCCCTGCGCCCGG + Intergenic
1187152950 X:16697935-16697957 GCCTCTTCTGTGCCGGGGCCTGG - Intronic
1187405084 X:18996680-18996702 GCCTCCTCCTGACCTGCCCCAGG + Intronic
1192206108 X:69097479-69097501 ACTTCTACGTGACCTGGGCCAGG + Intergenic
1198301706 X:135339764-135339786 GGCTCTTCTAGAGCTGGGCAAGG - Intronic
1200237130 X:154473070-154473092 GCCTCTTCTTGAGCTGTCCTGGG + Exonic
1202263030 Y:22989624-22989646 GCCTCCTCTTGACAGGGCCCAGG - Intronic
1202416020 Y:24623365-24623387 GCCTCCTCTTGACAGGGCCCAGG - Intronic
1202454767 Y:25046721-25046743 GCCTCCTCTTGACAGGGCCCAGG + Intronic