ID: 1184852936

View in Genome Browser
Species Human (GRCh38)
Location 22:47131158-47131180
Sequence GGGCCTGGTGGGAGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2508
Summary {0: 1, 1: 10, 2: 98, 3: 671, 4: 1728}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184852936_1184852948 22 Left 1184852936 22:47131158-47131180 CCCAGATGCCTCCCACCAGGCCC 0: 1
1: 10
2: 98
3: 671
4: 1728
Right 1184852948 22:47131203-47131225 ATTCCACCATGAGATTGAGAGGG No data
1184852936_1184852950 27 Left 1184852936 22:47131158-47131180 CCCAGATGCCTCCCACCAGGCCC 0: 1
1: 10
2: 98
3: 671
4: 1728
Right 1184852950 22:47131208-47131230 ACCATGAGATTGAGAGGGCATGG 0: 1
1: 0
2: 2
3: 20
4: 254
1184852936_1184852947 21 Left 1184852936 22:47131158-47131180 CCCAGATGCCTCCCACCAGGCCC 0: 1
1: 10
2: 98
3: 671
4: 1728
Right 1184852947 22:47131202-47131224 CATTCCACCATGAGATTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184852936 Original CRISPR GGGCCTGGTGGGAGGCATCT GGG (reversed) Intronic
Too many off-targets to display for this crispr