ID: 1184853591

View in Genome Browser
Species Human (GRCh38)
Location 22:47134844-47134866
Sequence TGCCAGGCAGAGGACCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184853591_1184853597 -4 Left 1184853591 22:47134844-47134866 CCTCCAGGGTCCTCTGCCTGGCA 0: 1
1: 0
2: 4
3: 50
4: 392
Right 1184853597 22:47134863-47134885 GGCAGGGCATGTTGCACCACAGG No data
1184853591_1184853598 -3 Left 1184853591 22:47134844-47134866 CCTCCAGGGTCCTCTGCCTGGCA 0: 1
1: 0
2: 4
3: 50
4: 392
Right 1184853598 22:47134864-47134886 GCAGGGCATGTTGCACCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 110
1184853591_1184853599 -2 Left 1184853591 22:47134844-47134866 CCTCCAGGGTCCTCTGCCTGGCA 0: 1
1: 0
2: 4
3: 50
4: 392
Right 1184853599 22:47134865-47134887 CAGGGCATGTTGCACCACAGGGG 0: 1
1: 0
2: 1
3: 6
4: 151
1184853591_1184853600 1 Left 1184853591 22:47134844-47134866 CCTCCAGGGTCCTCTGCCTGGCA 0: 1
1: 0
2: 4
3: 50
4: 392
Right 1184853600 22:47134868-47134890 GGCATGTTGCACCACAGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184853591 Original CRISPR TGCCAGGCAGAGGACCCTGG AGG (reversed) Intronic
900149271 1:1171143-1171165 TGCCTGGCTGGGGAGCCTGGGGG + Intergenic
900189440 1:1347100-1347122 TCCCAGCCAGAGGACCTGGGAGG + Intronic
900578150 1:3394340-3394362 GGCCAGGCGGAGGATCCAGGAGG + Intronic
900648069 1:3717959-3717981 AGCCAGGCCCAGGACCTTGGTGG + Intronic
900773443 1:4563785-4563807 TGGCAGGGAGAGGACCTAGGAGG + Intergenic
900980286 1:6042462-6042484 TGCCAGGCTTAGGGCCCTGCAGG + Intronic
901060076 1:6467897-6467919 TGCTGGGCAGAGACCCCTGGTGG + Exonic
901872449 1:12145975-12145997 TGCCTGGCAGAGGGGCCTGGTGG - Intergenic
902374751 1:16025127-16025149 TGCCAGGAAGGGGCCCATGGAGG + Intronic
902696251 1:18142882-18142904 TGCCAGGCAATGGCCACTGGGGG - Intronic
903354728 1:22739711-22739733 TCCCAGGCAGGTGACCCTTGGGG + Intronic
903968286 1:27102971-27102993 TCCCAGGCATAGGTCCCAGGTGG - Intronic
906205156 1:43982577-43982599 TTCTAGGCAGAGGGACCTGGAGG + Intronic
907014990 1:51004007-51004029 TGCCACAAAGAGCACCCTGGAGG + Intergenic
907120806 1:52006543-52006565 TCCTAGGCAGAGGTCCCTGCGGG - Intergenic
907219779 1:52897786-52897808 TGCCAGTCAGTGGGCCCTAGAGG - Intronic
907425321 1:54375811-54375833 TGCCTGCCACAGGGCCCTGGCGG + Intronic
909434922 1:75630151-75630173 TGCCACCCAGAGGGCCCTGCGGG - Intergenic
910493933 1:87804859-87804881 TCCCAGCCAGAGGATCCTGAGGG - Intergenic
910877337 1:91889378-91889400 TGACAGGTAGAAGAACCTGGTGG - Intronic
911723760 1:101220028-101220050 TGCCAGGCAGTGGAACCCCGGGG - Intergenic
912210068 1:107547487-107547509 TTCCAGGCAGAGGAAACTGCAGG + Intergenic
912274628 1:108243143-108243165 CTCCATCCAGAGGACCCTGGGGG - Intronic
912286639 1:108376715-108376737 CTCCATCCAGAGGACCCTGGGGG + Intronic
912293592 1:108451198-108451220 CTCCATCCAGAGGACCCTGGGGG + Intronic
912584486 1:110750059-110750081 TGCTAGGAAAAGGAACCTGGAGG - Intergenic
913377140 1:118165055-118165077 AGGCAGGCAGAGGACACTGTTGG - Intronic
913385684 1:118255909-118255931 GACCAGGGAGAGGGCCCTGGGGG + Intergenic
914381877 1:147123630-147123652 TTCCATGCTGAGGACCCTGGTGG - Intergenic
914843404 1:151266411-151266433 TGCCATGCAGATGTCCCTGCAGG + Exonic
915397954 1:155600183-155600205 TCCTAGGCAGAGGTCCCTGCGGG + Intergenic
915458186 1:156053978-156054000 CGCCAGGCGGGGGCCCCTGGGGG + Intergenic
915474771 1:156147115-156147137 AGTGAGGCAGAGGACCCTGGGGG + Intergenic
915564092 1:156704464-156704486 TGACTGGGAGAGGACTCTGGGGG - Intronic
916005027 1:160652438-160652460 TCCTAGGCAGAGGTCCCTGTGGG - Intergenic
916009373 1:160691085-160691107 TCCTAGGCAGAGGCCCCTGCAGG - Intronic
917460640 1:175225988-175226010 TGCCAGACAGATGCCCCTGCAGG - Intergenic
917551274 1:176032823-176032845 TAGCAGGCAGAGATCCCTGGAGG + Intronic
917997884 1:180460238-180460260 TGTCAGGCAGAGAACAATGGTGG - Intronic
919756570 1:201069737-201069759 GTCCAGCCAGAGGACCCTGCAGG - Intronic
919807287 1:201387705-201387727 TGCCCGGCAGCAGACTCTGGAGG - Intronic
919807543 1:201389278-201389300 TGCCCGGCAGAGGACTCTGGAGG - Exonic
919952723 1:202380329-202380351 TGGCAGGCAGAAGACTCAGGAGG + Intronic
920405233 1:205704059-205704081 AGCCAGGCAGAGGTCTCTGTTGG - Intergenic
920578682 1:207084067-207084089 TCCCAGGCAGAGAACCTAGGAGG - Intronic
920837988 1:209529702-209529724 AGCCAGGCAGAGAGTCCTGGTGG + Intergenic
921340903 1:214133328-214133350 TGTCAGTAAGAGGACCATGGTGG + Intergenic
921936479 1:220801240-220801262 TGCCAGGCAGAGGACACAGCTGG - Intronic
923616841 1:235545292-235545314 TGCCAGGCAGAGGAAGCTGCAGG + Intergenic
924009058 1:239644373-239644395 TCTGAGGCTGAGGACCCTGGGGG - Intronic
924709069 1:246519353-246519375 GGAAAGACAGAGGACCCTGGGGG - Intergenic
1062817124 10:508923-508945 TGCCAGGTGGCTGACCCTGGAGG - Intronic
1062923910 10:1299985-1300007 GGCCCGGTGGAGGACCCTGGAGG + Intronic
1063385566 10:5614208-5614230 CCCCAGGCAGAGGGCCCTAGTGG - Intergenic
1063606653 10:7528371-7528393 TGCCAGGCAGATGGCTCTTGGGG - Intergenic
1063777545 10:9281320-9281342 TTCCAGGAAGTGGACCCTTGTGG + Intergenic
1064250923 10:13705901-13705923 TTTCAGGCAGATTACCCTGGAGG + Intronic
1066650197 10:37647924-37647946 TTCCAGGTAGAAGATCCTGGTGG - Intergenic
1067146631 10:43698989-43699011 TTCCAGGGAAAGGACCCAGGGGG + Intergenic
1067837042 10:49647998-49648020 AGCAAGGCAGGGGACACTGGGGG + Intronic
1068817253 10:61331267-61331289 TTACAGGCAGAGGACGCTGTAGG - Intergenic
1069689871 10:70343397-70343419 TGCCTGGCAGAGGAGCCCTGTGG - Intronic
1070701093 10:78602290-78602312 TGTCAGGCAGAGGAGCCGGCAGG - Intergenic
1072290296 10:93959053-93959075 TGCCATGCAGATGTCCCTGCAGG - Intergenic
1072570752 10:96655610-96655632 TCCCAGTGAGAGGAACCTGGTGG + Intronic
1072622671 10:97090349-97090371 TCCCAGGCAGAGGAACCAGCAGG + Intronic
1073036147 10:100565410-100565432 TGCCAGGCTGAGGGGCCTAGGGG + Intergenic
1073110347 10:101059765-101059787 TGCTAGGGAGAGGAGCCAGGTGG - Intergenic
1074532529 10:114306865-114306887 TGCCAGGCAGTGGCCTCAGGGGG - Intronic
1074877050 10:117621771-117621793 TGGCAGGCTGAGGACCCTGATGG + Intergenic
1075831392 10:125414579-125414601 TGCCAGGCACTGGACCATGATGG + Intergenic
1076637194 10:131889812-131889834 TGCCGGGCCCAGGACACTGGGGG + Intergenic
1077014972 11:395435-395457 AGCAAGGCTGAGGCCCCTGGAGG - Intronic
1077249173 11:1553188-1553210 CTCCAGGGAGAGGACCCTGGAGG + Intergenic
1077474314 11:2779151-2779173 TGCCAGGCAGATGGCCCAGTGGG + Intronic
1080518978 11:33049959-33049981 TCCTAGGCAGAGGCCCCTGCTGG + Intronic
1080635633 11:34120996-34121018 TGCCAGGCCTAGGACACCGGAGG - Intronic
1080763200 11:35272495-35272517 TGCAAGGCAGAACACCCTTGAGG + Intronic
1081390620 11:42524668-42524690 TGGTAGGCAGGGGACCCAGGAGG + Intergenic
1081995113 11:47359116-47359138 TGGCAGGCACAGGAGACTGGAGG + Intronic
1084153803 11:67303222-67303244 TGCAGGGCACAGGACGCTGGAGG + Intergenic
1085522398 11:77146293-77146315 TGCCAGGCTGAGGAGCCCAGGGG + Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089113182 11:116072946-116072968 TGCCAGGCGGGGCCCCCTGGAGG + Intergenic
1089313203 11:117573616-117573638 TGCAGGGCAGAGGACGCTGATGG - Intronic
1089590211 11:119535306-119535328 TGGCTGGCAGAGGAACTTGGTGG - Intergenic
1089663573 11:120002017-120002039 TGACTGGCAGAGGCTCCTGGAGG + Intergenic
1090912681 11:131135189-131135211 AGCCATGCAGAGGGCACTGGGGG - Intergenic
1091853546 12:3720513-3720535 TGGCAGGCACAAGAGCCTGGCGG - Intronic
1094447736 12:30549959-30549981 TGCCAGGCAGAATTCCCTGTGGG - Intergenic
1096510632 12:52125977-52125999 TGCCAGCCAGGTGGCCCTGGGGG + Intergenic
1096842077 12:54385721-54385743 TGTCAGGCCCAGGCCCCTGGGGG - Intronic
1098268426 12:68746598-68746620 GGCCAGGAGGAGGAGCCTGGAGG - Exonic
1098989164 12:77045931-77045953 TGCCAGGTTGACAACCCTGGAGG - Intronic
1099957563 12:89365983-89366005 TGCCAGGGAGAGGAACTGGGTGG - Intergenic
1100402822 12:94246992-94247014 GGACAGGCAGAGGAGGCTGGTGG - Intronic
1101199636 12:102421118-102421140 TGCTTGGCACAGGACCCTGGTGG + Intronic
1102552366 12:113700956-113700978 AGCCAGGCTGAGGACTGTGGAGG - Intergenic
1102581211 12:113889268-113889290 TGGCAGGCAAAGTGCCCTGGTGG + Intronic
1102816016 12:115867205-115867227 TGCCATGCAGAGAAATCTGGAGG + Intergenic
1102940538 12:116937427-116937449 GGCCAGGCAGAGGACCGGGAAGG + Intronic
1103045080 12:117729471-117729493 TGCCAGGCAGAGTAATGTGGAGG - Intronic
1103715809 12:122944791-122944813 GGCCAAGCTGAGGAGCCTGGGGG - Intronic
1103910333 12:124348574-124348596 TTGCAGACAGAGCACCCTGGAGG - Intronic
1105688743 13:22814299-22814321 TCCTAGGCAGAGGTCCCTGCGGG + Intergenic
1105700908 13:22935240-22935262 TGCCAGGTAGGGGACCCCTGTGG - Intergenic
1106087876 13:26558610-26558632 TGCAAGGGAGAGTTCCCTGGTGG + Intronic
1108510118 13:51148440-51148462 TGCCATGCAGAGAACAATGGTGG + Intergenic
1108549787 13:51532352-51532374 TGTCAGGCAGGGGGCGCTGGGGG + Intergenic
1108689924 13:52850867-52850889 TGCCGGGCGGAGGACCCGGAAGG + Intergenic
1110808648 13:79788734-79788756 TGTCAGGCTGAAGGCCCTGGTGG - Intergenic
1113838590 13:113346159-113346181 TGCCTGACAGTGGACCCGGGAGG + Intronic
1113838665 13:113346485-113346507 TGCCTGACAGTGGACCCGGGAGG + Intronic
1113838694 13:113346605-113346627 TGCCTGACAGTGGACCCGGGAGG + Intronic
1113838758 13:113346873-113346895 TGCCTGACAGTGGACCCGGGAGG + Intronic
1115967840 14:38912058-38912080 TGTCAGCCAGAGAACACTGGTGG - Intergenic
1116877547 14:50127878-50127900 TGAAAGGCAGAAGACCGTGGAGG + Intronic
1116932397 14:50703103-50703125 TGTCAGTCAGAAGGCCCTGGTGG + Intergenic
1117575843 14:57096358-57096380 TCCCATGCAGAGCACACTGGAGG + Intergenic
1117661946 14:58015487-58015509 TACTATGCAGAGGACCCTGGCGG - Intronic
1118382875 14:65231933-65231955 TGCCAGGCAGATTACCAGGGAGG + Intergenic
1119646804 14:76354205-76354227 GGGCGGGTAGAGGACCCTGGGGG - Intronic
1120830988 14:88997044-88997066 TGCCAGCCAGAGGCACCTGGAGG - Intergenic
1121126066 14:91407433-91407455 TGCGAGGCACAGGTCCCAGGCGG + Intronic
1121325859 14:93019255-93019277 TCCCAGGCAGGGAAACCTGGAGG - Intronic
1121717608 14:96087437-96087459 TGCCAGGCAGTGGACTCTTCAGG + Exonic
1122425839 14:101604814-101604836 GGGCAGGGAGAAGACCCTGGTGG + Intergenic
1122598258 14:102908187-102908209 TCCCAGGCAGACGCTCCTGGCGG + Exonic
1123106183 14:105842310-105842332 TGCCAGGGAGCGGGCACTGGTGG - Intergenic
1124357766 15:29009545-29009567 TGGCTGGGAGAGGACCCTAGGGG - Intronic
1124695531 15:31861529-31861551 GAACAGGCAGAGGACCCTGGAGG + Intronic
1125754926 15:42057092-42057114 AGCCAGGCAGCAGACGCTGGGGG + Intergenic
1126085911 15:45011185-45011207 TGACAGGCATAGGACCCAGGAGG - Intergenic
1126404890 15:48313708-48313730 TTCCAGGCAGAGGACACAGCAGG - Intergenic
1126785788 15:52177001-52177023 AGCTAGGCAGAGGCCCCAGGAGG - Intronic
1127260602 15:57323953-57323975 AGCCAGGCAGAGTTTCCTGGAGG + Intergenic
1127266624 15:57367421-57367443 TGCCTGCCAGAGGAGCCAGGAGG - Intergenic
1128305878 15:66598679-66598701 TGCCAGGCTGAGGGGTCTGGAGG - Intronic
1128339454 15:66810245-66810267 GGCCAGGCAGAGGACTCAGGGGG + Intergenic
1129537958 15:76329699-76329721 TGCCACGCTGAGGAGCTTGGAGG - Intergenic
1130191631 15:81741915-81741937 TGCCAGGCAGAGAACACCAGTGG - Intergenic
1132532847 16:462073-462095 TGCCAGGCACAGGACTCTGTCGG - Intronic
1132698182 16:1211161-1211183 GGCCCGGCTGATGACCCTGGAGG - Exonic
1132764510 16:1527378-1527400 TGCCGAGCAGAGGGCCCTGGAGG + Intronic
1134483318 16:14636785-14636807 TCCTAGGCAGAGGTCCCTGCGGG + Intronic
1135169726 16:20173236-20173258 CCACAGGCAGAGCACCCTGGAGG - Intergenic
1136598004 16:31265303-31265325 TGCCACCCAGAGGACGGTGGGGG - Intronic
1137673825 16:50294011-50294033 CTGCAGGCAGAGGACCCAGGGGG - Intronic
1138526397 16:57610199-57610221 TGGCAAGCACAGGACCCTGGAGG - Intergenic
1138689414 16:58753642-58753664 TGCCAGCCAGAGACCTCTGGTGG + Intergenic
1138928036 16:61615959-61615981 TGCCTTACTGAGGACCCTGGAGG - Intergenic
1139574136 16:67830754-67830776 TGCCAGGCAGAGGAACAGGAAGG - Intronic
1139640939 16:68290876-68290898 TGCCAGGCTGGGGACCCAGCTGG - Intronic
1139923634 16:70474197-70474219 TGCATGGCAGAGGGCCGTGGGGG + Exonic
1141597041 16:85103766-85103788 TGCCAGGCCCTGGACCCTGGTGG + Intronic
1141647296 16:85374665-85374687 AGCCAGGCCCATGACCCTGGAGG + Intergenic
1141650591 16:85390791-85390813 TGCCTGTCAGAGGAGCCGGGAGG - Intergenic
1142153647 16:88523551-88523573 CTCCAGGCTGGGGACCCTGGTGG + Intronic
1142287056 16:89175768-89175790 TCCCAGGCAGGGGACCCTGCCGG - Intronic
1142376580 16:89709833-89709855 GGCCAGGCAGCGGTCCTTGGAGG + Exonic
1142703430 17:1678715-1678737 TGCCTGGGTGAGGACGCTGGAGG - Intronic
1142716722 17:1751056-1751078 TTCCAGGCAGAGTACCCGTGTGG - Intronic
1144441650 17:15287907-15287929 TGCCCGAGAGAGGACCCTGGAGG - Intergenic
1145050927 17:19659906-19659928 TTCCAGGCAGAGTAACTTGGGGG + Intronic
1145269477 17:21396960-21396982 GGCCAGGCAGATGACCTTGATGG - Intronic
1145785010 17:27587983-27588005 TTCCAGGCAGAAGCCCCTGGAGG - Intronic
1145956874 17:28860760-28860782 TGCCAGGCAGAGGAACCACCTGG - Exonic
1146502118 17:33373115-33373137 TGCCAAGAAGAGAACCCAGGAGG + Intronic
1146767930 17:35540736-35540758 TGCCAGTCACAGAACCCAGGAGG - Intergenic
1147479707 17:40748298-40748320 TTCCAGGGAGTGGAGCCTGGTGG + Exonic
1147674055 17:42192839-42192861 TGCAAGTCAGAGGTCTCTGGTGG + Intronic
1148127019 17:45242216-45242238 CCCCAGGCAGAGGACCCTGGAGG - Intronic
1150006269 17:61470804-61470826 CGCCGGGCACAGGACCCTGCTGG - Intronic
1150227085 17:63530091-63530113 TACCAGGCAGCGGAAGCTGGAGG - Exonic
1150227186 17:63530583-63530605 AGCCTGGGAGGGGACCCTGGAGG - Intronic
1150527547 17:65938286-65938308 TCCTAGGCAGAGGACCCTGCGGG - Intronic
1151783988 17:76266170-76266192 TGCCCGGCACTGGTCCCTGGGGG + Intronic
1151979867 17:77502390-77502412 TGCCTGGCAGAAGAGCCAGGGGG - Intergenic
1153060666 18:991606-991628 TGGCTGGCAGAGGCCACTGGAGG - Intergenic
1153641957 18:7165167-7165189 TGCCAGGCTGGGCACCCAGGAGG - Intergenic
1156368140 18:36448492-36448514 GGCCAGGCAGTGGACAGTGGTGG + Intronic
1156486142 18:37466903-37466925 TGCCAGGCAAAGGAAACTAGTGG + Intronic
1156645503 18:39156480-39156502 TGCCAGCCAGAGGTCCCAGCTGG + Intergenic
1157207254 18:45711115-45711137 TCCCTGGAAGAGGGCCCTGGGGG - Intergenic
1157330375 18:46699816-46699838 TGCCAGGTGGAGGTTCCTGGAGG - Intronic
1157337277 18:46750623-46750645 TGCCAGGAAGAGGGCTCGGGTGG - Intronic
1159621628 18:70645358-70645380 GGACAGGCAGATGAACCTGGGGG - Intronic
1160115269 18:76073463-76073485 TGCCTCGCTGAGCACCCTGGAGG + Intergenic
1160705793 19:529682-529704 TGCCGGGCAGAGGGGCCTGAGGG + Intergenic
1160949096 19:1657239-1657261 TGCCAGGCAGGGGAAGCTGAGGG + Intergenic
1160957762 19:1701548-1701570 TGCCAGGAAGTGGGCCATGGCGG - Intergenic
1161039207 19:2100968-2100990 GGCCAGGCAGAAGACCCATGTGG + Intronic
1161107673 19:2452837-2452859 GGCCAGGCCGAGGAGCCTGCTGG - Intronic
1161139214 19:2637903-2637925 TGCCATGCTGAGGTCCCAGGAGG + Intronic
1161204051 19:3031229-3031251 TGTCTGGGAGAGGACCCTTGGGG + Intronic
1161280599 19:3443580-3443602 TGCCCTGCAGAGGTCCCAGGAGG - Intronic
1161427303 19:4210560-4210582 TTCCAGGCAGAGGACACTGGTGG - Intronic
1161427313 19:4210617-4210639 TTCCAGGCAGAGGACACAGGTGG - Intronic
1161447874 19:4328266-4328288 TGCTAGGCAGGGGAGCATGGGGG - Intronic
1161533950 19:4807329-4807351 GGACAGGAAGAGGATCCTGGGGG + Intergenic
1161696447 19:5771228-5771250 TTCCAGGGAGAGGGCCCTGGGGG - Intronic
1162203134 19:9035735-9035757 GGCCAGGGATGGGACCCTGGAGG - Intergenic
1163166979 19:15505284-15505306 TGGCAGGCTGAGGGCTCTGGTGG + Intergenic
1163298694 19:16429668-16429690 TGCCAGGCTGAGGAGCAGGGTGG - Intronic
1163737468 19:18990273-18990295 GGTCAGGCAGAGGCCCCTGCAGG + Intergenic
1165327319 19:35121705-35121727 TTCCAGGCAGAGGAACCAGCAGG - Intronic
1165481703 19:36068483-36068505 TCCTAGGCAGAGGACCCTGCGGG + Intronic
1166330108 19:42073120-42073142 TGGCAGGCAGGTGAGCCTGGGGG + Intronic
1166851861 19:45765136-45765158 TGACAGGGAGAGGGCTCTGGGGG + Exonic
1167114417 19:47480392-47480414 GTCCAGCCAGAGGACGCTGGCGG + Exonic
1167123482 19:47533020-47533042 AGGCAGGCAGAGGACCCTGTCGG - Intronic
1167834039 19:52052022-52052044 TCCTAGGCAGAGGTCCCTGTGGG - Intronic
926676981 2:15633100-15633122 AACAAGGCAGAGGAACCTGGTGG + Intergenic
927480802 2:23452401-23452423 TGGGAGGCATTGGACCCTGGAGG - Intronic
927488255 2:23503991-23504013 AGCCAGCCAGAGGTCCCTGAGGG + Intronic
929922168 2:46180338-46180360 TGCCAGGGAGATGAACCTGGGGG + Intronic
930612282 2:53555694-53555716 TGCTACCCAGAGGGCCCTGGAGG + Intronic
931372471 2:61676655-61676677 TTCCAGGCAGAGGACTCCGGTGG - Intergenic
931646293 2:64424834-64424856 TGCCAGGCATAGGAGCCACGTGG - Intergenic
933678276 2:85076981-85077003 TTACAGGCAGAGGACACAGGTGG + Intergenic
933794038 2:85906017-85906039 TGCCTGATAAAGGACCCTGGGGG - Intergenic
933838034 2:86261599-86261621 TCCTAGGCAGAGGTCCCTGCGGG - Intronic
933942055 2:87253257-87253279 TGTCAGGAACAGGATCCTGGAGG + Intergenic
934623703 2:95832078-95832100 TGGCAGCCTGAGGACACTGGGGG + Intergenic
934809228 2:97266588-97266610 TGCCAGCCCGAGAACACTGGTGG + Intergenic
934810052 2:97270017-97270039 TGGCAGCCTGAGGACACTGGAGG - Intergenic
934827640 2:97437922-97437944 TGGCAGCCTGAGGACACTGGAGG + Intergenic
934828277 2:97490581-97490603 TGCCAGCCCGAGAACACTGGTGG - Intergenic
934851992 2:97707438-97707460 TGCCAGGCACAGTGCCCTGGTGG + Intergenic
935261904 2:101362901-101362923 TTCCTGCCTGAGGACCCTGGTGG + Intronic
935734808 2:106097973-106097995 TGCCAGGAAGGGCACACTGGAGG + Intronic
936840134 2:116758546-116758568 TGGCAGTCAGAGCTCCCTGGAGG - Intergenic
937397076 2:121546638-121546660 TGTCAGACTGAAGACCCTGGTGG - Intronic
938303193 2:130230442-130230464 TTCCATGCAGCGGACCCTGACGG + Intergenic
938783053 2:134602780-134602802 GGACAGGCAGAAGACCCAGGAGG - Intronic
938964150 2:136373330-136373352 TGCTGGGTAGAAGACCCTGGTGG + Intergenic
939877640 2:147595893-147595915 TCCCAGGCAGGGGTACCTGGGGG - Intergenic
940855325 2:158724740-158724762 TGGCAGGGAAGGGACCCTGGAGG + Intergenic
941815327 2:169790191-169790213 TTCCTGGCAGAGCATCCTGGTGG + Intergenic
943838240 2:192542587-192542609 TCCTAGGCAGAGGTCCCTGCGGG + Intergenic
945316509 2:208376998-208377020 TCCTAGGCAGAGGACCCTGCGGG + Intronic
947811119 2:233004492-233004514 AGACAGGAAGAGGACCCTGGAGG - Intronic
948137967 2:235651240-235651262 TCACAGGCCGAGGAACCTGGTGG + Intronic
948289377 2:236813884-236813906 TGGCAGGCAGAGCTGCCTGGGGG - Intergenic
948860428 2:240750202-240750224 TGCCCCGCAGTGGGCCCTGGAGG - Intronic
1168947886 20:1776942-1776964 TGCGAGGTGGAGGGCCCTGGTGG + Intergenic
1169264151 20:4157518-4157540 TGAGAGTCAGAGGATCCTGGTGG + Intronic
1169707036 20:8517579-8517601 TGCCAGGTGGAGGTCACTGGGGG - Intronic
1170460463 20:16573025-16573047 TGCCCTGGAGAGGACCCTGGTGG - Intronic
1170480522 20:16760731-16760753 AGCCAGGTAGACGACCATGGGGG + Intronic
1170927720 20:20741220-20741242 TGGCAGGCAGGGGAGCCTGGGGG - Intergenic
1172095109 20:32456720-32456742 GGCCTGTCAGAGGGCCCTGGAGG + Intronic
1172133775 20:32673631-32673653 TGCCGGGCAGAGGAGCCTGCAGG - Intergenic
1172222729 20:33284832-33284854 TGCCAGGGAGAGGAGCTTGGGGG - Intronic
1172391304 20:34567193-34567215 TGGGAGGCAGAGGAGGCTGGCGG + Intronic
1172490663 20:35334457-35334479 TGCCAGGCAGAGGAACAGTGTGG - Intronic
1173143665 20:40506565-40506587 TGCCAGGCTGGGCACCCTGAAGG - Intergenic
1173430518 20:42983478-42983500 TGGGAGGCAGAACACCCTGGTGG - Intronic
1173446348 20:43122317-43122339 TGCCAGACAGAGGACCAAGAGGG - Intronic
1173472382 20:43333727-43333749 TCCTAGGCAGAGGACCCTTTTGG - Intergenic
1173984423 20:47250135-47250157 TCCCAGGCAGAGGCCTCTGGGGG + Intronic
1174117169 20:48234399-48234421 GGCCAGGCAAGGCACCCTGGGGG + Intergenic
1174863483 20:54114193-54114215 GGGCAGGCAGAGGCACCTGGTGG + Intergenic
1174894449 20:54434152-54434174 GGCGAGCCAGGGGACCCTGGTGG - Intergenic
1175010122 20:55726386-55726408 TGACAGGGAGAGGACACTGAGGG + Intergenic
1175604525 20:60301720-60301742 TGCAAAGGAGTGGACCCTGGTGG + Intergenic
1175697866 20:61116019-61116041 AGCCGGGGAGAGGACCCTGGAGG - Intergenic
1176097911 20:63352775-63352797 GCGCGGGCAGAGGACCCTGGGGG - Intronic
1176925643 21:14745659-14745681 GGCCAGGCACAGGGCCCTGCTGG - Intergenic
1178113339 21:29392317-29392339 TCCTAGGCAGAGGTCCCTGCGGG + Intronic
1178589299 21:33895970-33895992 TGCCAGGCAGCACACCCAGGAGG + Exonic
1179243179 21:39609614-39609636 TGCCAGGCGGAGGTCTCTGCTGG + Exonic
1179783369 21:43716591-43716613 TTCCAGGGAGAGAGCCCTGGAGG - Intergenic
1180041415 21:45282217-45282239 TCACAGACAGCGGACCCTGGGGG - Intronic
1180088105 21:45517127-45517149 TGCCACGCAGAGCTCCCTGGGGG + Intronic
1180756517 22:18165712-18165734 TGGCAGGGAGAGTTCCCTGGTGG - Intronic
1181030049 22:20145311-20145333 GGGCTGGCAGAGGGCCCTGGGGG - Intronic
1181075252 22:20371721-20371743 TGGCAGGGAGAGTTCCCTGGTGG + Intronic
1181407858 22:22697559-22697581 TGCCAAGCAGAGGGCGCTGTGGG + Intergenic
1181415848 22:22758354-22758376 TGCCAAGCAGAGGGCACTGCAGG + Intronic
1181420140 22:22792141-22792163 TGCCAAGCAGAGGGCACTGCAGG + Intronic
1181910298 22:26233367-26233389 TTGCGGGCTGAGGACCCTGGAGG + Intronic
1182490579 22:30668723-30668745 GGCCAGGCAGAGGGAACTGGGGG - Intronic
1183263757 22:36813211-36813233 TGAGAGGCAGAGGATCCTTGGGG + Intronic
1183383984 22:37504457-37504479 TGCCAGGCATAGGTGCCAGGAGG - Intronic
1183984525 22:41562188-41562210 TCCCAGGGAGAGGCCCCTGCCGG - Intronic
1184853591 22:47134844-47134866 TGCCAGGCAGAGGACCCTGGAGG - Intronic
1185140646 22:49099291-49099313 TGACAGGCGGTGGACCCAGGTGG + Intergenic
1185188818 22:49419875-49419897 TGCAACGCCAAGGACCCTGGTGG - Intronic
1185374648 22:50476610-50476632 GGGCAGGGAGGGGACCCTGGTGG - Intergenic
950549506 3:13657729-13657751 CGCCAGGCAGAGGGACCTGCAGG + Intergenic
950582643 3:13872598-13872620 TGGCAGGCAGAGGTGGCTGGGGG - Intronic
950749454 3:15117285-15117307 AGCGGGGAAGAGGACCCTGGAGG - Intergenic
953632524 3:44631202-44631224 TACCATGCTGAGGATCCTGGAGG - Exonic
954707108 3:52487029-52487051 TCCCAGGATGAGGGCCCTGGTGG - Intronic
954934062 3:54310872-54310894 TGTCAAGGAAAGGACCCTGGTGG + Intronic
955159442 3:56449322-56449344 TGCCAGGCACAGGCTCCAGGTGG + Intronic
956939161 3:74136705-74136727 CCCCAGGCAGAGGAACTTGGAGG + Intergenic
961512042 3:127409188-127409210 TGACAGGGGTAGGACCCTGGAGG - Intergenic
962015247 3:131432256-131432278 AGCCAGGCAGAGGTCACTGTGGG + Intergenic
962201439 3:133403859-133403881 AGCCAGGAAGAGGAGCCAGGAGG + Intronic
962281843 3:134057997-134058019 TGTCAGCCAGGTGACCCTGGTGG + Intergenic
964487987 3:157205766-157205788 AGCCAGTCAGAGGGCCCTGGGGG - Intergenic
965604686 3:170486234-170486256 TGTCAGGCAGATGACCAGGGAGG + Exonic
966000682 3:174944721-174944743 TGTCAGACTGAAGACCCTGGTGG + Intronic
967016637 3:185488414-185488436 GGCTAAGCAGAGGACCCTTGTGG + Exonic
968221658 3:196944375-196944397 TCCTAGGCAGAGGTCCCTGTGGG - Intergenic
968532214 4:1098461-1098483 GGCCAAGCAGAGCATCCTGGAGG + Intronic
968558801 4:1265405-1265427 TGCCAGACAGGGGACCATGTGGG + Intergenic
968661639 4:1801134-1801156 GTCCGGGCAGAGCACCCTGGAGG + Intronic
968832730 4:2941545-2941567 GCCCAGGCAGAGCACCCTAGTGG + Intronic
968912374 4:3482867-3482889 TGCCAGGCTGAGCACCTTGCCGG - Intronic
968961933 4:3750063-3750085 GACCAGGCAGAGGACCCAGAGGG + Intergenic
968982970 4:3860669-3860691 CCCCAGGCAGAGGCCCATGGTGG + Intergenic
969057923 4:4413695-4413717 TGCCAGGCACAGGCCCCTGGAGG + Intronic
969626125 4:8306617-8306639 TGCCAGCCTGGGGTCCCTGGAGG + Exonic
969682693 4:8652115-8652137 GGCCAGGCAGAGGACTCTGACGG - Intergenic
969720901 4:8892663-8892685 CGGCGGGCAGAGGACCCAGGAGG - Intergenic
970469322 4:16360959-16360981 TCCGAGTCAGAGTACCCTGGAGG + Intergenic
971263287 4:25076360-25076382 TCCCAAGCAAAGGACCCTGGTGG - Intergenic
971498879 4:27297241-27297263 TTCCAGGCATAGGATCATGGAGG + Intergenic
971594678 4:28514322-28514344 TCCTAGGCAGAGGACCCTGCGGG + Intergenic
972442005 4:39103576-39103598 AACCAGGCAGAGGACCCGTGTGG + Intronic
976866906 4:89739312-89739334 TCCCAGCCAGAGGACCATAGTGG + Intronic
977359228 4:95981970-95981992 TGGCAGGCATAGGACCCAGACGG + Intergenic
980167122 4:129242429-129242451 TGGCTGGCAGAGAACCATGGAGG + Intergenic
981866307 4:149423553-149423575 TGCAAGGGAGAGGAGCATGGAGG - Intergenic
983690731 4:170465695-170465717 GGCCAGGCAGGGATCCCTGGAGG + Intergenic
983939226 4:173523718-173523740 TGCCAGGGAGCGCAGCCTGGGGG - Intergenic
985493657 5:193090-193112 TGCCCAGCAGTGGATCCTGGAGG + Intronic
985940402 5:3131283-3131305 TGGCAGGCAGGGGAGCCAGGCGG - Intergenic
986249804 5:6045494-6045516 TCCCAGGGAGTGGACCGTGGAGG - Intergenic
988238363 5:28575624-28575646 GGCCAGGCAGGGGTCCCGGGAGG - Intergenic
988594964 5:32582880-32582902 TGCCAGGAAGAAGTTCCTGGAGG - Intronic
989211171 5:38861246-38861268 TCCTAGGCAGAGGACCCTGCGGG + Intronic
991419606 5:66427779-66427801 TGGAAGGCAGCGGATCCTGGAGG - Intergenic
992781045 5:80128285-80128307 TTCCAGCCAGAAGACCCTGAGGG - Intronic
993452525 5:88090167-88090189 TGCCAAGCAAATGACCCTGTAGG + Intergenic
993669353 5:90741251-90741273 AGACAGGCAGAGGACTCTGATGG - Intronic
995113479 5:108453779-108453801 AGCCAGGCCCAGGGCCCTGGTGG + Intergenic
997733360 5:136196209-136196231 TGACAGGCAGAGGTCACAGGGGG + Intergenic
998142590 5:139708620-139708642 TGCCAGGCAGAGGGCACAGCAGG - Intergenic
998736104 5:145143075-145143097 TGTAAGGCAGAGGACCTTGTAGG + Intergenic
999386681 5:151158440-151158462 TTCCAGGCAGAGGAAACTGCTGG + Intergenic
999760734 5:154699037-154699059 TTCCAGGCAGAACATCCTGGCGG - Intergenic
1000113700 5:158133919-158133941 AGGCAGGCAGAGTACCCGGGAGG - Intergenic
1000456351 5:161454262-161454284 TGCCTGGCATGGGACCCAGGTGG - Intronic
1002482820 5:179514609-179514631 TCCTAGGCAGAGGTCCCTGCGGG + Intergenic
1003896582 6:10613919-10613941 TCCCAGGCTGAGCACCCTGATGG - Intronic
1004850156 6:19690955-19690977 TGCCAGGAAAAGGACCATGAAGG - Intergenic
1005336570 6:24802576-24802598 TTCCAGGCAGAGGCAACTGGAGG - Intronic
1005528070 6:26671994-26672016 TTCCAGGAAGAGAACCCTGCTGG - Intergenic
1005542725 6:26829645-26829667 TTCCAGGAAGAGAACCCTGCTGG + Intergenic
1006348930 6:33506505-33506527 TGCCTGAAAGAGGACTCTGGGGG - Intergenic
1006373563 6:33659598-33659620 AGGCAGGAAGAGGGCCCTGGTGG - Intronic
1006593915 6:35179010-35179032 AGAAAGGCAGAGGAGCCTGGAGG + Intergenic
1006855596 6:37131129-37131151 GGCCAGGCAGAGGAAACTGCTGG + Intergenic
1008556942 6:52681597-52681619 TGCAAGGCAGAGGAGCCCTGAGG - Intronic
1008786413 6:55174417-55174439 TGCCCGGCAGAAGACTCCGGAGG + Exonic
1009013541 6:57871792-57871814 TTCCAGGAAGAGAACCCTGCTGG + Intergenic
1014940842 6:127436878-127436900 TGCCAGACAGATATCCCTGGAGG - Intergenic
1015444952 6:133293025-133293047 TGCAAGCCAGAGACCCCTGGGGG - Intronic
1016995798 6:149961868-149961890 TGCCACCCTCAGGACCCTGGGGG + Intergenic
1017063902 6:150510882-150510904 TCCTAGGTAGAGGACACTGGCGG - Intergenic
1017536292 6:155350452-155350474 TGCCAGACTGAAGGCCCTGGTGG + Intergenic
1018798896 6:167207648-167207670 TGCCAGGGGGAGGGCCCGGGAGG + Intergenic
1019601479 7:1885889-1885911 TGCCGGGCAGGGGTCCCTGCTGG - Intronic
1019661909 7:2229223-2229245 GTCCAGGCAGAGGAGCCTAGAGG + Intronic
1020140818 7:5610673-5610695 TCCCAGGCAGAGAGGCCTGGAGG + Intergenic
1020315428 7:6902294-6902316 TCCCAGGCAGAGGTCCCTGTGGG - Intergenic
1022164325 7:27742299-27742321 TCCTAGGCAGAGGTCCCTGCAGG + Intronic
1024237005 7:47406478-47406500 AGCCAGGCAGATGTCCCTGCAGG + Intronic
1024968233 7:55044459-55044481 TGCCAGGCAGAGGTCACTACGGG + Intronic
1026045796 7:66904487-66904509 TGCCTGGCGTAGGCCCCTGGGGG + Intergenic
1026783088 7:73283414-73283436 TCCTAGGCAGAGGACCCTGCGGG + Intergenic
1027220562 7:76211262-76211284 TGCCAGGCAGAGGCACAAGGAGG + Intronic
1029732278 7:102446437-102446459 TGCCTGGCAGGTGGCCCTGGTGG + Intronic
1031026552 7:116685989-116686011 TTCCAGGAGGGGGACCCTGGTGG - Intronic
1031306358 7:120131643-120131665 AGCCAGGCAGAGGTCACTGCAGG + Intergenic
1032097611 7:128947390-128947412 TGCCAGGGGGAGGAGCCAGGGGG - Exonic
1032533849 7:132644439-132644461 TGCCAGGCAGAAGAGCCATGGGG - Intronic
1033732724 7:144195339-144195361 TGTGTGGCTGAGGACCCTGGTGG - Intronic
1033743575 7:144293919-144293941 TGTGTGGCTGAGGACCCTGGTGG - Intergenic
1033750327 7:144355678-144355700 TGTGTGGCTGAGGACCCTGGTGG + Intronic
1034553916 7:151837973-151837995 AGACACGCACAGGACCCTGGAGG + Intronic
1035249994 7:157590824-157590846 TGGGAGGCAGAGGAGCCAGGAGG - Intronic
1035268150 7:157703638-157703660 AGCCAGGCAGAGGCACCTGCAGG + Intronic
1035654311 8:1294028-1294050 TGCCCGGCAGGGAGCCCTGGTGG - Intergenic
1035905567 8:3506205-3506227 TGTCAGGGAGACGGCCCTGGGGG + Intronic
1036529509 8:9570572-9570594 TGCCAGGTAGAGGTTGCTGGGGG - Intronic
1036687709 8:10923006-10923028 TGTCAGGAAGAGGCCCCAGGTGG - Intronic
1036701488 8:11016344-11016366 TGCGGTGCTGAGGACCCTGGGGG + Intronic
1037934518 8:22906226-22906248 GTCCAGGCAGAGGACACTGCAGG + Intronic
1037946653 8:22993783-22993805 TGCCAGGCAGACAGCTCTGGAGG - Intronic
1038668221 8:29560074-29560096 TGCCAGCCGGAGGCCCCTTGAGG - Intergenic
1038871350 8:31497277-31497299 TGCCAATCAGAGGACGCTAGGGG + Intergenic
1039444690 8:37621732-37621754 TGCAGGGAAGAGGCCCCTGGTGG - Intergenic
1040705531 8:50122100-50122122 TGTATGGCAGAGGACACTGGGGG - Intronic
1041171143 8:55142922-55142944 TGCTAGGCAGCGGTCCCTTGTGG + Intronic
1041607022 8:59793374-59793396 TGCCAGGCAGTGGTCACTGTGGG + Intergenic
1042371631 8:67998261-67998283 GGCCAGGCAGAGGAGCTTAGAGG - Intronic
1044727263 8:95203708-95203730 TGCTGGGCAGAGGAGCCTGAAGG + Intergenic
1045309454 8:100987898-100987920 AGCCAGGCGGTGGAGCCTGGAGG + Intergenic
1046078755 8:109344348-109344370 AGTGAGGCAGAGGGCCCTGGAGG - Exonic
1048177171 8:132163311-132163333 AACCAGGCAGAGGACTATGGTGG + Intronic
1048952046 8:139504539-139504561 AGCCATGCCGAGGAGCCTGGGGG - Intergenic
1049377733 8:142296949-142296971 AGCCTGTCAGAGGACCCAGGGGG - Intronic
1049737044 8:144214115-144214137 GGCCAAGGAGAGGTCCCTGGTGG - Intronic
1049737221 8:144215461-144215483 AGTGAGGCAGATGACCCTGGAGG + Intronic
1050275972 9:4000797-4000819 TGCCTGGCAGAGGAAGCTGCAGG - Intronic
1056203211 9:84296250-84296272 TGCCAGGTAGAGGTTGCTGGGGG + Intronic
1057441630 9:95087875-95087897 AGCCAGGCAGAGGAGACTGTGGG - Intergenic
1057445604 9:95112379-95112401 GGCCAGGCAGAGGAACATGCAGG - Intronic
1058449365 9:105081642-105081664 TGTCAGGCAGACTTCCCTGGTGG + Intergenic
1059344263 9:113617313-113617335 TGCCTGGCAGCAGCCCCTGGAGG + Intergenic
1059610211 9:115884289-115884311 TGCCATGTAGAAGATCCTGGAGG + Intergenic
1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG + Intergenic
1060547861 9:124471268-124471290 TGACAGGGAGAGGTGCCTGGGGG - Intronic
1060549490 9:124478231-124478253 GGGCTGGCAGAGGATCCTGGTGG - Intronic
1060812268 9:126616450-126616472 TGCCAGGCAGAAAACCCAGGAGG - Intronic
1061059305 9:128242799-128242821 TCCAAGGCAGGTGACCCTGGGGG + Intronic
1061482404 9:130903512-130903534 AGCCAGGCTGAGGCCCTTGGGGG + Exonic
1061595947 9:131629121-131629143 TGCCAGGCAGAGGAGGCTTGGGG + Exonic
1061898027 9:133658610-133658632 AGCCATGCAGGGGACCCTGGGGG - Exonic
1061993648 9:134173433-134173455 GCCCAGGCAGAGGCCCCGGGAGG + Intergenic
1062001908 9:134220375-134220397 TGCCAGTCTGTGTACCCTGGTGG + Intergenic
1062460046 9:136659233-136659255 TGCCAGGCAGGGGTGCCTGCGGG - Exonic
1062591420 9:137276469-137276491 TGACACAGAGAGGACCCTGGAGG - Intergenic
1185619029 X:1442206-1442228 CGCCAAGCAGAAGGCCCTGGAGG - Exonic
1187046833 X:15655378-15655400 TGCAGTGCAGAGGTCCCTGGAGG - Intronic
1187053063 X:15713571-15713593 TGCAGTGCAGAGGTCCCTGGAGG - Intronic
1188983326 X:36748297-36748319 TGTCAGACAGAAGGCCCTGGTGG + Intergenic
1189269034 X:39737382-39737404 TGCCAGGCAGACAAGGCTGGAGG - Intergenic
1190302017 X:49062526-49062548 TGACCGGCAGCGGACCCTGCAGG + Exonic
1192858408 X:75039389-75039411 GGCCAGGCAGTGGTCCCTTGCGG - Intergenic
1194067837 X:89284227-89284249 TGTCAGCCAGAGAACACTGGGGG + Intergenic
1195104781 X:101593524-101593546 TGTCAGACAGAGAACACTGGTGG + Intergenic
1195416140 X:104621493-104621515 TGGCAGAGAGAGCACCCTGGGGG - Intronic
1197398439 X:125957780-125957802 TGGCAGGTGGAGGTCCCTGGAGG + Intergenic
1197961080 X:132006714-132006736 TGCCAGGCACAGGAGCCATGTGG - Intergenic
1198725652 X:139674649-139674671 TACCAGCCAGAGGAGACTGGGGG - Intronic
1198995677 X:142571278-142571300 TGCCAGACAGAAGTCCCTGGTGG - Intergenic
1199259231 X:145751482-145751504 TATCAGGCAGAGAAGCCTGGAGG - Intergenic
1200721981 Y:6618387-6618409 TGTCAGCCAGAGAACACTGGCGG + Intergenic
1201440195 Y:14000518-14000540 TCCTAGGCAGAGGACCCTGCGGG + Intergenic
1201444376 Y:14042190-14042212 TCCTAGGCAGAGGACCCTGCGGG - Intergenic
1202581918 Y:26390947-26390969 TGGCAGGCAGAAGACTCAGGAGG - Intergenic