ID: 1184858349

View in Genome Browser
Species Human (GRCh38)
Location 22:47158697-47158719
Sequence CGGCCAGGTGGCCCGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184858342_1184858349 13 Left 1184858342 22:47158661-47158683 CCCTGCAGAGGACACACCACACA 0: 1
1: 0
2: 1
3: 29
4: 286
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167
1184858341_1184858349 14 Left 1184858341 22:47158660-47158682 CCCCTGCAGAGGACACACCACAC 0: 1
1: 0
2: 0
3: 20
4: 209
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167
1184858345_1184858349 -3 Left 1184858345 22:47158677-47158699 CCACACAGCTCTGGTTTCTTCGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167
1184858338_1184858349 26 Left 1184858338 22:47158648-47158670 CCTGCTCAGGACCCCCTGCAGAG 0: 1
1: 1
2: 2
3: 33
4: 281
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167
1184858340_1184858349 15 Left 1184858340 22:47158659-47158681 CCCCCTGCAGAGGACACACCACA No data
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167
1184858343_1184858349 12 Left 1184858343 22:47158662-47158684 CCTGCAGAGGACACACCACACAG 0: 1
1: 0
2: 1
3: 26
4: 240
Right 1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184858349 Original CRISPR CGGCCAGGTGGCCCGTCCTG TGG Intronic
900158180 1:1211861-1211883 CGGCATGGGGGCCCCTCCTGTGG - Intronic
900158821 1:1213893-1213915 CAGCCAGGAGGCTGGTCCTGGGG - Intronic
900168461 1:1254486-1254508 CGCCCAGGAGGCCCGGCCTGCGG + Intronic
900368647 1:2321732-2321754 CGGTCCGGTGGCCAGTCCTGTGG - Intronic
900475739 1:2875607-2875629 CCGCCTGGTGGCCTGGCCTGGGG + Intergenic
900637152 1:3671558-3671580 CCGCCAGGCAGCCCGTCCTCTGG - Intronic
900936874 1:5771611-5771633 AGGCCAGATGGCCCGGCATGGGG + Intergenic
903273689 1:22207839-22207861 CGGCCAGGTGGCTTGTCCATTGG + Intergenic
903639522 1:24848741-24848763 TGCCCAGGTGGCCCCTCCCGCGG - Intergenic
903773414 1:25778182-25778204 AGGCCAGGTGCCCCATCTTGTGG - Exonic
903779110 1:25810370-25810392 CTGACAGGTGGCCAGCCCTGAGG - Intronic
904083252 1:27885405-27885427 CGGGCCTGTGGCCCTTCCTGTGG - Exonic
905124674 1:35708238-35708260 AGGCCTGGAGGCCCCTCCTGGGG + Intergenic
907140648 1:52182067-52182089 CGGCCAGCTGCCCCGTCCGGAGG + Intronic
910412665 1:86963805-86963827 CGGCCAGCCGCCCCGTCCAGGGG - Intronic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
1064032826 10:11894004-11894026 AGGCCAGATGGCCCCTCCTGTGG - Intergenic
1065976557 10:30847186-30847208 GGGCCAGGTTGCCAGTCATGTGG + Intronic
1066716532 10:38292761-38292783 GGGCCAGGTGGCGGGTCCTTTGG + Intergenic
1067568930 10:47357522-47357544 CCTGCAGGTGGCCCGGCCTGAGG + Exonic
1069827165 10:71261354-71261376 CGGCCACCTGGCCAATCCTGAGG - Intronic
1072663649 10:97379084-97379106 AGGCCAGGTGGCCCTCCCTGTGG - Intronic
1076450534 10:130554176-130554198 GGGGCAGGTGGCCAGTGCTGGGG + Intergenic
1076676206 10:132148982-132149004 CGGCCACGTGGGCCTGCCTGTGG + Intronic
1077120482 11:905249-905271 CCGCCACGTGGCCCAGCCTGTGG - Intronic
1077212959 11:1382012-1382034 TGCCCAGGTGGCCCTTGCTGGGG - Intergenic
1077358677 11:2130196-2130218 CAGCCAGGAGCCCCCTCCTGTGG + Intronic
1077442219 11:2574173-2574195 GGGCCAGGTGGGCCGTCCACAGG + Intronic
1081596311 11:44462028-44462050 CTTCCAGGTGGCCTCTCCTGGGG + Intergenic
1083120841 11:60510485-60510507 CGGCCAGCCGCCCCGTCCGGAGG + Intergenic
1083619667 11:64042583-64042605 TGGCCTGGTGGCCAGGCCTGTGG + Intronic
1084272401 11:68036345-68036367 CTGCCAGGAGGCCTGTCCCGTGG + Exonic
1085384815 11:76151356-76151378 AAACCAGGTGGCTCGTCCTGCGG - Intergenic
1088513276 11:110599595-110599617 GGGCCAGGCTGCCAGTCCTGTGG + Intronic
1088597723 11:111452424-111452446 CCGCCAGGGGGCCAGTGCTGTGG + Intronic
1090186598 11:124743102-124743124 CTGCCAGGTGGCCAGTCCACAGG - Intronic
1091926564 12:4355989-4356011 TGGCCTGGTGGCCTGTGCTGAGG + Intergenic
1096688955 12:53307750-53307772 CTGCCAGGTGGCCCTTCTTTGGG - Intronic
1097284210 12:57865275-57865297 CGGGCTGGGGGCCCGGCCTGGGG + Intergenic
1102046347 12:109832552-109832574 ACACCAGGTGGCCTGTCCTGGGG - Intronic
1104712794 12:130997195-130997217 CGGCCAGCTGCCCCGTCCGGGGG - Intronic
1104919631 12:132283755-132283777 CTCCCAGGTGTCCCCTCCTGGGG - Intronic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1111177300 13:84612206-84612228 CAGCCAGGTGGGCAGTCCAGGGG - Intergenic
1113533685 13:111047549-111047571 GGGCGAGGTGGCCCAGCCTGCGG - Intergenic
1113679008 13:112229360-112229382 AGGCCTGGTGGCACCTCCTGTGG - Intergenic
1116090078 14:40293775-40293797 CCGCCAGGTGGCCCGACTTTAGG - Intergenic
1118702541 14:68448083-68448105 CAGCCAGTTGGCCCATACTGAGG + Intronic
1121649918 14:95550368-95550390 CGGACAGGTGGCCAGGCCAGAGG + Intergenic
1122782405 14:104149292-104149314 GGGCCTCGTGGCCCGTCCTGGGG + Intronic
1124436275 15:29651964-29651986 GGGCCAGGCCGCCAGTCCTGTGG + Intergenic
1124564644 15:30801846-30801868 TGGCCAGGTGGCCTCTCCTTGGG - Intergenic
1125566608 15:40682989-40683011 CGGCCAGCCGCCCCGTCCGGGGG + Intergenic
1127154329 15:56110391-56110413 CGGCCAGCCGCCCCGTCCGGGGG + Intronic
1128490111 15:68135463-68135485 CGGCCAGCCGCCCCGTCCGGGGG - Intronic
1129388039 15:75206708-75206730 AGGCCAGGAAGCCCGTGCTGTGG - Exonic
1129428499 15:75481506-75481528 CGGCCAGCCGCCCCGTCCGGAGG + Intronic
1129537980 15:76329792-76329814 CGGCCATGTGGGCCTGCCTGGGG + Intergenic
1129803960 15:78438569-78438591 CGGTGGGGTGGCCCGCCCTGCGG - Intronic
1131373683 15:91905929-91905951 CAGCAAGGTGGCCCGACTTGGGG - Intronic
1132873098 16:2124300-2124322 GGGCGAGGGGGCCCGACCTGGGG - Intronic
1133139599 16:3734482-3734504 CAGGCAGGTGCCCCCTCCTGGGG + Intronic
1133751991 16:8732896-8732918 CGGCCAGCCGCCCCGTCCGGAGG - Intronic
1134552187 16:15143481-15143503 GGGCGAGGGGGCCCGACCTGGGG - Intergenic
1136408519 16:30063723-30063745 CAGCGAGGTGCCCAGTCCTGAGG - Exonic
1137445890 16:48531942-48531964 CGGCCAGCTGGCCTGTGCTCGGG - Intergenic
1142145672 16:88491958-88491980 CAGCCAGGTGACCGGTCCAGTGG + Intronic
1142149088 16:88504884-88504906 AGGCCCAGTGGCCTGTCCTGGGG - Intronic
1142414989 16:89936434-89936456 GGGGCAGGTGGTCCCTCCTGCGG + Intergenic
1147570139 17:41565300-41565322 CAGCCAGGTGGCTCTTCCTCTGG - Intergenic
1151351834 17:73536478-73536500 TGCCCAGGTGGCCCAGCCTGGGG - Intronic
1152240809 17:79160029-79160051 CTGCCTGTTGGCCCTTCCTGGGG - Intronic
1152743886 17:82030532-82030554 TGGCCAGGTCTCCCGTGCTGAGG + Intronic
1152781441 17:82228905-82228927 CGGCCCGGGAGCCCGTCCGGAGG + Intronic
1152930912 17:83109471-83109493 TGGCCAGGTGGCTGCTCCTGCGG + Intergenic
1153997463 18:10454598-10454620 CGGCCAGGCTGCCCGGCCGGCGG + Intergenic
1156353528 18:36321971-36321993 CAGCCAGGTGGCCCTGCCTCTGG - Intronic
1157233544 18:45941924-45941946 CGGCCTGGGGGTCCCTCCTGAGG - Intronic
1159092149 18:63861333-63861355 CTGCCATGTGGCCCCTGCTGGGG + Intergenic
1161238307 19:3208607-3208629 CGGCCAGTTGGTCCTCCCTGGGG + Exonic
1162485882 19:10960555-10960577 GGTCCAGGCGGCCCGTCCTACGG + Intergenic
1164693534 19:30227566-30227588 CTGCGAGGTGTCCCGGCCTGCGG + Intergenic
1165278187 19:34772874-34772896 CGGCGAGGAAGCCGGTCCTGCGG + Exonic
1167096360 19:47376813-47376835 CGGTCAGGGGGCCTGTCCTATGG + Intronic
1167346241 19:48947194-48947216 GGGCCAGGGTGCCAGTCCTGTGG + Intergenic
929739608 2:44588447-44588469 CGGCCAGCCGCCCCGTCCGGAGG + Intronic
930665489 2:54095882-54095904 CGGCCAGCCGCCCCGTCCGGAGG - Intronic
931463502 2:62467814-62467836 AGGCCAGGTGGCAGGGCCTGGGG + Intergenic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
937149310 2:119674853-119674875 CTGCCAGGTGGCCCTGGCTGGGG - Intergenic
938398468 2:130967879-130967901 CTTCCAGGTGTCCCCTCCTGTGG + Intronic
938828888 2:135033466-135033488 CGGCCAGCCGCCCCGTCCGGGGG - Intronic
941603000 2:167563630-167563652 CGGCCAGCCGCCCCGTCCCGAGG - Intergenic
945877222 2:215291148-215291170 CTGCTAGGTTGCCTGTCCTGTGG - Intergenic
1170471731 20:16674629-16674651 CGGCCACGTGGCCAGGTCTGGGG + Intergenic
1172096757 20:32464188-32464210 CAGGCAGGGGGCCAGTCCTGGGG - Intronic
1173001725 20:39110050-39110072 AGGCCAGGTGGCTGGTACTGAGG + Intergenic
1173893837 20:46534540-46534562 GGGCCAGGCTGCCAGTCCTGTGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174482644 20:50842233-50842255 CGGCCAGGTTGCCCTTCCTGAGG + Intronic
1175327776 20:58141751-58141773 TGGGCAGGTGGCCAGGCCTGTGG - Intergenic
1176135414 20:63520233-63520255 CGGGCAGCAGGCGCGTCCTGGGG + Intergenic
1176408399 21:6434289-6434311 GGGCCAGGCTGCCAGTCCTGTGG + Intergenic
1178536005 21:33411024-33411046 AGGCCAGGGGGCCTGTCCTTGGG - Intronic
1178876130 21:36415548-36415570 TGGCCAGGTGCCCCCTGCTGAGG - Intronic
1179080426 21:38165754-38165776 AGGCAAGGTGGCCCGGCCTAAGG - Intronic
1179683892 21:43042615-43042637 GGGCCAGGCTGCCAGTCCTGTGG + Intergenic
1179725165 21:43337902-43337924 CTGCCAGGTGGCCCCTCCCCGGG + Intergenic
1180178942 21:46109425-46109447 GGGCCGGGTTGCCCGTCCTACGG - Intronic
1182331150 22:29552547-29552569 CGGCCAGCCGCCCCGTCCGGGGG + Intronic
1183453893 22:37911116-37911138 CAGCCAGCTGTCCCGTGCTGGGG + Intronic
1183480320 22:38060638-38060660 CGGCCAGGAGGCCAGGCCTGGGG - Intronic
1184069271 22:42138089-42138111 CAGAGAGGTGGCCAGTCCTGTGG + Intergenic
1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG + Intronic
1185035589 22:48475057-48475079 AGGCCAGGTCCCCCGGCCTGTGG - Intergenic
950506929 3:13400778-13400800 CGGCTTAGTGGCCCCTCCTGGGG - Intronic
950754861 3:15163208-15163230 CGGCCAGCCGCCCCGTCCGGAGG - Intergenic
950992069 3:17449761-17449783 CCCCCAGGTGCTCCGTCCTGGGG - Intronic
951184960 3:19702664-19702686 CGGCCGGCTGGCCGGCCCTGTGG + Intergenic
951584609 3:24202952-24202974 AGGCCAGTTGACCCATCCTGAGG - Intronic
951658552 3:25036622-25036644 GGTCCAGGTGGCCAGTTCTGGGG - Intergenic
953537786 3:43789180-43789202 CGCCCATGTGGCCCCTCTTGGGG + Intergenic
954101894 3:48380002-48380024 GGGCCAGTTGGCCCCTCCTTAGG - Intronic
954381488 3:50221339-50221361 AGGGCAGGGGGCCCTTCCTGGGG - Intergenic
959419366 3:106111902-106111924 CGGCCAGCCGCCCCGTCCGGAGG - Intergenic
962063282 3:131952590-131952612 CGGCCAGCCGCCCCGTCCGGAGG + Intronic
968089638 3:195892257-195892279 GGGCCAAGTGGCCTCTCCTGCGG - Intronic
968667376 4:1828779-1828801 CGGCCAGCCGCCCCGTCCGGGGG - Intronic
969756414 4:9153157-9153179 CGGTCAGGAGGTGCGTCCTGGGG - Intergenic
974118805 4:57613072-57613094 AGGGCAGGTGGCCTGTGCTGTGG + Intergenic
976647347 4:87399945-87399967 GGGCCAGGTTGCCAGTTCTGTGG + Intergenic
980730950 4:136823896-136823918 GGGCCAGGGTGCCAGTCCTGTGG - Intergenic
981533358 4:145774433-145774455 CGGCCAGGTGGCAGGTGCTCTGG + Intronic
982600541 4:157443629-157443651 CTGGCAGGTGGCCCTGCCTGGGG + Intergenic
985818126 5:2141789-2141811 CACCCAGGTGCCCCCTCCTGGGG - Intergenic
987999583 5:25331125-25331147 AGACCAGGTTGCCAGTCCTGTGG + Intergenic
991073772 5:62513700-62513722 CGGCCAGCCGCCCCGTCCGGGGG - Intronic
991913904 5:71587421-71587443 CCGCCATGTGGGCCGTCCTGAGG + Exonic
991977183 5:72194921-72194943 TGGCCAGGTGCCCACTCCTGTGG + Exonic
1001953019 5:175829401-175829423 TGGCAAGGGGGCCCTTCCTGGGG - Intronic
1002201405 5:177530799-177530821 CTGCCAGGAGGGCCCTCCTGAGG + Intronic
1003114276 6:3273043-3273065 AGGCCATGTAGCCCGGCCTGCGG - Exonic
1013086380 6:106861357-106861379 AGGCCAGGCTGCCAGTCCTGGGG - Intergenic
1015643585 6:135363861-135363883 CGGCCAGCCGCCCCGTCCGGGGG - Intronic
1017888732 6:158622019-158622041 CAGCCAGGTGGGCTGTCCGGAGG - Intronic
1018907831 6:168085531-168085553 GAGCCCAGTGGCCCGTCCTGGGG - Intergenic
1019480451 7:1264391-1264413 TGGCCAGGTACCCCGTTCTGTGG + Intergenic
1019592523 7:1842838-1842860 CGCCCAGCTGGCCCTCCCTGTGG + Intronic
1020204799 7:6105591-6105613 CAGCCAGGTGGCTAGGCCTGGGG - Intronic
1020675074 7:11173743-11173765 AGCCCAGGAGGCCCGTCCAGTGG - Intergenic
1021852311 7:24820490-24820512 CGGCCAGGTGGCGAGTGATGAGG + Intronic
1022005523 7:26262369-26262391 CGGCCAGCCGCCCCGTCCGGAGG + Intergenic
1024980816 7:55156184-55156206 CTGCCAGGTGCCCAGCCCTGGGG + Intronic
1025808371 7:64856565-64856587 TGGCCAGCTGCCCCGTCCGGAGG + Intergenic
1026867948 7:73834877-73834899 AGGCCTGGTGGCCTGGCCTGTGG - Exonic
1029569263 7:101359361-101359383 CGGCCAGCCGCCCCGTCCGGAGG - Intergenic
1030098276 7:105920924-105920946 GGGCCAGGTAGCCAGTCCTGTGG + Intronic
1034411031 7:150942319-150942341 CAGCCAGGTGCCCAGCCCTGCGG + Intergenic
1035259579 7:157652971-157652993 GGGCCAGGAGGCCCTTCCTGTGG + Intronic
1035405652 7:158595427-158595449 TTACCAGGTGGCCTGTCCTGAGG - Intergenic
1035609350 8:949591-949613 CAGCGGGGAGGCCCGTCCTGGGG - Intergenic
1039570506 8:38582593-38582615 CTGCTTGGTGGCCAGTCCTGTGG + Intergenic
1044660698 8:94590969-94590991 CGGCCAGCCGCCCCGTCCAGAGG + Intergenic
1047104672 8:121719871-121719893 GGGCCAGGCTGCCAGTCCTGTGG - Intergenic
1047847927 8:128826126-128826148 CGGCCAGCCGCCCCGTCCGGAGG - Intergenic
1048325246 8:133434192-133434214 CTGCCAGGCAGCCCCTCCTGGGG - Intergenic
1049203191 8:141351707-141351729 GGGCCTTGTGGCCTGTCCTGGGG + Intergenic
1049435671 8:142585146-142585168 GGGCGCGGTGGCCCGGCCTGGGG + Intergenic
1051265818 9:15307343-15307365 CGGGCAAGTGGCCCGGCCAGCGG - Exonic
1058371367 9:104271431-104271453 GGGCGAGGTGGGCAGTCCTGAGG + Intergenic
1059958439 9:119542309-119542331 CGGCCAGTTTGCCATTCCTGTGG + Intergenic
1060835280 9:126751115-126751137 TGGACAGGTGTCCTGTCCTGTGG - Intergenic
1061625902 9:131840517-131840539 TGGCCTGGTGGCCTGGCCTGCGG - Intergenic
1061989885 9:134153140-134153162 AGCACAGGTGGCCCGTCCAGGGG - Intronic
1062493686 9:136821735-136821757 CAGCCCGGCGGCCCGGCCTGTGG - Intronic
1062525315 9:136975893-136975915 CGGGCAGGAGGCCAGTCTTGTGG + Intergenic
1189014090 X:37077795-37077817 CCGCCAGGTGGCCCGACCCAGGG + Intergenic
1192107021 X:68326750-68326772 TGGCCAGGCGCCCCGTCCGGAGG + Intronic
1192150424 X:68708903-68708925 AGCCCAGGTGGCCCGGACTGAGG - Intronic
1193635420 X:83944119-83944141 TGGCCTGTTGGCCTGTCCTGAGG - Intergenic
1196501231 X:116385275-116385297 AGGCCAGGTTGCCCTACCTGAGG - Intergenic