ID: 1184859021

View in Genome Browser
Species Human (GRCh38)
Location 22:47162850-47162872
Sequence CACGAGGAAGTGCCTACACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184859021_1184859024 -8 Left 1184859021 22:47162850-47162872 CCCGGTGTAGGCACTTCCTCGTG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1184859024 22:47162865-47162887 TCCTCGTGGTCTTGATATGTAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1184859021_1184859026 9 Left 1184859021 22:47162850-47162872 CCCGGTGTAGGCACTTCCTCGTG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1184859026 22:47162882-47162904 TGTAGGCCCTCCCCTCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184859021 Original CRISPR CACGAGGAAGTGCCTACACC GGG (reversed) Intronic
901418981 1:9137419-9137441 CACGGGGCAGTGGCCACACCGGG - Intergenic
903765371 1:25730769-25730791 GAGGAGGAAGTGCCCACACAGGG - Intronic
904046644 1:27613157-27613179 CACGGGGAAGGGCTTCCACCTGG - Intronic
909905432 1:81189223-81189245 CAAGAGAAAGTGCCCACAGCAGG + Intergenic
910615995 1:89198794-89198816 CACGCTGCAGTGCCCACACCAGG - Exonic
912995289 1:114526909-114526931 CAGGAAGAATTGCCTGCACCTGG + Intergenic
923602957 1:235419761-235419783 CAGGTGGAAGTTTCTACACCGGG + Intronic
1067061769 10:43081452-43081474 CATGCGGAAGTCCCTACACAGGG - Intronic
1072762202 10:98065932-98065954 CATGAGTCTGTGCCTACACCTGG - Intergenic
1075857019 10:125638204-125638226 CACGGGGAGGGGCCTGCACCTGG - Intronic
1076870969 10:133194725-133194747 CACGTGGGAGTACTTACACCAGG + Intronic
1077163090 11:1122454-1122476 AACCTGGAAGTGCCTGCACCTGG + Intergenic
1078760264 11:14245838-14245860 CACGAGGCAGGGCCTACCCAGGG + Intronic
1078780613 11:14435655-14435677 CTCCAGGAAATGCCTATACCAGG + Intergenic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1104010659 12:124927833-124927855 AAAGAGGAAGTGCCGAAACCCGG + Intergenic
1118964514 14:70567443-70567465 AAGGAGGCAGTGCCAACACCAGG + Intergenic
1119164859 14:72483817-72483839 CAGGAAGAAGAGCTTACACCAGG - Intronic
1120474402 14:84969377-84969399 CAAGAGGAAGTGCTTGCTCCAGG - Intergenic
1122693309 14:103541563-103541585 CATGAGGGCCTGCCTACACCTGG - Intergenic
1124367965 15:29087509-29087531 CACCAGGGAGTGGCCACACCTGG - Intronic
1128941231 15:71789371-71789393 CACGAGCAAGTTCCCTCACCTGG - Intergenic
1130017072 15:80195874-80195896 CAAGAGGAACTGCTTCCACCAGG + Intergenic
1138365965 16:56477414-56477436 CACTTGGAAGTGACTACACATGG - Exonic
1143595221 17:7909892-7909914 CAGGAGTCAGTGACTACACCAGG - Intronic
1151178017 17:72305129-72305151 CACCAGGAGGTGCCCACACCAGG + Intergenic
1154094768 18:11402414-11402436 CACGAGGCAGTGGAGACACCAGG + Intergenic
1155931187 18:31710593-31710615 TACGAGGGAGTGCCTAGTCCAGG - Intergenic
1159580792 18:70232538-70232560 CAGGAGGAAATCCCTATACCAGG - Intergenic
1160455591 18:78996845-78996867 CACGAGTAAGTGCCTAGACACGG - Intronic
1161321147 19:3642085-3642107 CTCCAGGCAGTGCCTGCACCTGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1166912027 19:46165694-46165716 CACGAGGCAATGCCTGCACTTGG + Intergenic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
931981871 2:67701869-67701891 CACCAGAAACTGCCTACATCTGG + Intergenic
936585145 2:113750819-113750841 CACGAAACAGTGCCTACACTAGG + Intronic
941889461 2:170563677-170563699 CACCAGAAATTGCCTACCCCTGG - Intronic
943370458 2:187009881-187009903 GACGAAGAAGTTCCTACCCCAGG - Intergenic
943733764 2:191331307-191331329 CATGTGGAGGAGCCTACACCAGG - Intronic
1170540531 20:17382949-17382971 AACTAGGAAGTGGCTACACAGGG - Intronic
1173907594 20:46640220-46640242 TACAAGAAAGTGCCGACACCTGG - Intronic
1174411000 20:50335594-50335616 CAGGGGGAAGTGCTTAAACCAGG - Intergenic
1176012016 20:62902715-62902737 CAAGAGGCAGTGCTTCCACCTGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179366684 21:40765332-40765354 GAGGAGGAAGTGCCTCCTCCAGG - Intronic
1180146643 21:45923818-45923840 CACGAGGAGATGCGAACACCGGG + Intronic
1180146651 21:45923884-45923906 CACGAGGAGATGCGAACACCGGG + Intronic
1180146658 21:45923950-45923972 CACGAGGAGATGCGAACACCGGG + Intronic
1180146665 21:45924016-45924038 CACGAGGAGATGCGAACACCGGG + Intronic
1180146711 21:45924412-45924434 CACGAGGAGATGCGAACACCGGG + Intronic
1180146782 21:45925006-45925028 CACGAGGAGATGCGAACACCGGG + Intronic
1182912374 22:33995849-33995871 CAAAAGGAAGCGTCTACACCAGG - Intergenic
1184859021 22:47162850-47162872 CACGAGGAAGTGCCTACACCGGG - Intronic
950643212 3:14361546-14361568 CACTGGGAAGTGTCTACCCCAGG - Intergenic
954593297 3:51802587-51802609 CAAGAGGAACTGCACACACCTGG + Intergenic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
962954100 3:140248289-140248311 CATGAGGAAGTGCCACCACCAGG + Intronic
975659190 4:76671460-76671482 AAGGAGGAAGTGGCTACAGCTGG - Intronic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
1004005377 6:11633095-11633117 CACAAGGACTAGCCTACACCTGG - Intergenic
1004020993 6:11775419-11775441 CACAAAGAAGTGCCTAGCCCAGG + Intronic
1013317136 6:108953965-108953987 CAGGAGGAAGAGCCCTCACCAGG - Intronic
1016898895 6:149080935-149080957 CAGGAGGATGTGCCTACTCCTGG - Intergenic
1022637845 7:32154114-32154136 CAGGTGCAAGTGACTACACCTGG - Intronic
1023868374 7:44249663-44249685 CACCAGGAAGTGCCACCTCCCGG + Intronic
1032767726 7:135015113-135015135 CAAGAAGAAGTGCCTATATCAGG + Intronic
1033283795 7:140023931-140023953 CCCAAGGAAGTGCATCCACCTGG - Exonic
1043263511 8:78231974-78231996 CAAGAGAAAGTGCCCACAACTGG + Intergenic
1048540137 8:135334827-135334849 CAGGAGGCAGTGCCTAGACAAGG - Intergenic
1061861581 9:133471178-133471200 CAGGAGGAAGTGGCCACGCCAGG + Exonic
1062695631 9:137874701-137874723 GGTGAGGAAGTGCCTACAGCAGG - Intergenic
1062695636 9:137874740-137874762 AGTGAGGAAGTGCCTACAGCAGG - Intergenic
1062695640 9:137874779-137874801 AGTGAGGAAGTGCCTACAGCAGG - Intergenic
1062695644 9:137874818-137874840 AGTGAGGAAGTGCCTACAGCAGG - Intergenic
1062695686 9:137875169-137875191 AGTGAGGAAGTGCCTACAGCAGG - Intergenic
1186476749 X:9863404-9863426 GACGAGGACGTGGCTGCACCAGG - Intronic
1197945163 X:131830816-131830838 CACGGGCCAGTTCCTACACCTGG + Intergenic
1198102939 X:133437548-133437570 CAGAAGGAAGGGCCAACACCTGG - Intergenic