ID: 1184859426

View in Genome Browser
Species Human (GRCh38)
Location 22:47164859-47164881
Sequence CCTCCTGCGCAGGGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 330}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184859426_1184859432 7 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859432 22:47164889-47164911 ATGCTCCACTGTCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 254
1184859426_1184859435 13 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859435 22:47164895-47164917 CACTGTCTGCAGAAAGGCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 252
1184859426_1184859434 12 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859434 22:47164894-47164916 CCACTGTCTGCAGAAAGGCCCGG 0: 1
1: 0
2: 1
3: 32
4: 247
1184859426_1184859438 20 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859438 22:47164902-47164924 TGCAGAAAGGCCCGGGGGTTTGG 0: 1
1: 0
2: 1
3: 19
4: 186
1184859426_1184859440 25 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859440 22:47164907-47164929 AAAGGCCCGGGGGTTTGGGTAGG 0: 1
1: 0
2: 0
3: 18
4: 186
1184859426_1184859439 21 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859439 22:47164903-47164925 GCAGAAAGGCCCGGGGGTTTGGG No data
1184859426_1184859437 15 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859437 22:47164897-47164919 CTGTCTGCAGAAAGGCCCGGGGG 0: 1
1: 0
2: 2
3: 16
4: 194
1184859426_1184859436 14 Left 1184859426 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 330
Right 1184859436 22:47164896-47164918 ACTGTCTGCAGAAAGGCCCGGGG 0: 1
1: 0
2: 1
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184859426 Original CRISPR CCTCCTGCGCAGGGGCTGCA GGG (reversed) Intronic
900158579 1:1213090-1213112 CTTCCTGAGCAGGGGCCGGATGG + Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900552966 1:3265660-3265682 CCTCTTGCCCCGGGGCTGCCTGG + Intronic
900620774 1:3586740-3586762 CCTGCTGGGAAGGGGCTGCAGGG - Intronic
901615314 1:10534821-10534843 CCTCCCACGGAGGGGTTGCAGGG + Intronic
902631545 1:17707514-17707536 CGTCTTGCGCAGGGTCTGCCAGG + Intergenic
903010025 1:20323241-20323263 CATCCTGCTCAGGCTCTGCATGG - Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903542205 1:24102907-24102929 CCTCCAGCCCTGGGGCTGGACGG + Intronic
903578061 1:24351386-24351408 CCCCCTTCCCAGGGGCTGCAGGG - Intronic
903967618 1:27100242-27100264 CCACCAGAGCAGGGGCTGCTGGG - Exonic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
905174109 1:36125447-36125469 CCTCGAGGGCAGGGGCTGCGCGG - Intergenic
905443691 1:38010627-38010649 CCTCCAGCTCAGGAGCTCCAGGG - Intronic
906949965 1:50326620-50326642 CCTCGTGCGCAGAGGCTACTGGG + Intergenic
910935482 1:92482823-92482845 CCTCTTGGGCGGGAGCTGCAGGG - Intronic
913645029 1:120847601-120847623 CCTCCTGCGCAGGACCTAAACGG + Intergenic
914081700 1:144415951-144415973 CCTCCTGCGCAGGACCTAAACGG - Intergenic
914099404 1:144570897-144570919 CCTCCTGCGCAGGACCTAAACGG + Intergenic
914176605 1:145284484-145284506 CCTCCTGCGCAGGACCTAAACGG - Intergenic
914299579 1:146366780-146366802 CCTCCTGCGCAGGACCTAAACGG - Intergenic
914490210 1:148146900-148146922 CCTGGTGCGCAGGGCCTGCCAGG - Intronic
914531334 1:148525963-148525985 CCTCCTGCGCAGGACCTAAATGG - Intergenic
914637059 1:149561777-149561799 CCTCCTGCGCAGGACCTAAACGG + Intergenic
915652861 1:157331736-157331758 CCCCCTGCCCAGGGGCTTCCAGG - Intergenic
915727504 1:158028237-158028259 CTGCCTGCGCAGGGGCTGTTGGG + Intronic
915834795 1:159168186-159168208 CCTCCCGGGCAGGAGCAGCATGG + Intergenic
917596223 1:176531953-176531975 CCTCCTGTGTAAGGGCTGCCTGG + Intronic
919781673 1:201225252-201225274 CCTCCAGGGCAGGGGCTGTGTGG - Intronic
920103020 1:203529674-203529696 CCTACTGCGTGGGGGCAGCAGGG - Intergenic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
921390326 1:214608313-214608335 CCTGGTGCGCAGGGCCTGCCAGG + Intronic
922273643 1:224056846-224056868 CCTCCTGCAGAGGAGCTGCACGG - Intergenic
922273766 1:224057785-224057807 CCTCCTGCAGAGGAGCTGCACGG + Intergenic
922722259 1:227905045-227905067 CCTTCTGTCCAGGGGCTGCTGGG - Intergenic
924064149 1:240207084-240207106 CCTCCTGTGGATGGGCTGCCAGG + Exonic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064985269 10:21203845-21203867 CTGCCTGCACACGGGCTGCAAGG - Intergenic
1065494501 10:26314849-26314871 CCTCCTGAGCACTGGCTGCAGGG - Intergenic
1065666940 10:28072995-28073017 ACTGCTGTCCAGGGGCTGCATGG - Intronic
1065687750 10:28302910-28302932 CCTCCGGGCCCGGGGCTGCAGGG - Intronic
1066455170 10:35566145-35566167 CTCCCTGCTCAGGGGCTCCAAGG - Exonic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1070771531 10:79085256-79085278 CAGCCTGCCCAGGTGCTGCAGGG - Intronic
1071334192 10:84588363-84588385 CCTGCTGAGTGGGGGCTGCAGGG - Intergenic
1071718900 10:88123259-88123281 CCTCCTGCAGTGGGGCTGCAGGG + Intergenic
1074829873 10:117240992-117241014 CCTCCTGCGCAGCGACGGCGCGG + Intergenic
1075572436 10:123556075-123556097 CCTCCTGCGCAGGTGCCCCAGGG + Intergenic
1076722315 10:132397996-132398018 GCACCTGTGCACGGGCTGCAGGG + Intronic
1077229108 11:1450692-1450714 CCTCCGACGCTGGGGCTGGACGG - Exonic
1077282459 11:1751877-1751899 CTTCCTCCCAAGGGGCTGCAGGG - Intronic
1077332841 11:1990882-1990904 GCTCCTGGGAAGGGGGTGCAGGG - Intergenic
1077396588 11:2326787-2326809 CCTCTGCCGCAGGGGCTGTAGGG - Intergenic
1077500473 11:2907773-2907795 ACTCCTCCGGAGGGGCTGAAGGG + Intronic
1079246363 11:18755183-18755205 CCTCTGGCCCAGAGGCTGCAAGG + Intronic
1081527170 11:43935044-43935066 CAGCCTGTGCCGGGGCTGCAGGG - Intronic
1082162475 11:48900512-48900534 GCTCCGCCGCAGGCGCTGCAGGG + Intergenic
1082174875 11:49048505-49048527 GCTCCGCCGCAGGCGCTGCAGGG + Intergenic
1082238949 11:49852224-49852246 GCTCCGCCGCAGGCGCTGCAGGG - Intergenic
1083340404 11:61955451-61955473 CCTCCCGCGCAGGGGCTCCAGGG - Intronic
1084390722 11:68874992-68875014 GCTCCTGGGCAGCGGCCGCATGG - Intergenic
1084519958 11:69657069-69657091 GCTTCTGCGAAGGGGCTGCAGGG - Intronic
1084889821 11:72231141-72231163 CCTACTGCGCGGGGGCCTCAAGG + Exonic
1085205644 11:74730684-74730706 CCTCCGGCACAGGTGCTGCCTGG + Intronic
1086690900 11:89787581-89787603 GCTCCGCCGCAGGCGCTGCAGGG - Intergenic
1086714901 11:90052074-90052096 GCTCCGCCGCAGGCGCTGCAGGG + Intergenic
1088748278 11:112822663-112822685 CCTCCTGCAGAGGGGCTGATGGG - Intergenic
1089065119 11:115656766-115656788 CCTCCTGAGCAGTGGCAGCAGGG + Intergenic
1089489034 11:118870199-118870221 CCTCCAGCTCAGTGGCTGCTGGG + Intergenic
1090075421 11:123577604-123577626 CCTCCTTGTCAGGGGCTGCGGGG + Intronic
1090404644 11:126469430-126469452 CCTCCTCCCCCAGGGCTGCAAGG - Intronic
1090670122 11:128940153-128940175 GTTCCTGTGCAGGGGCTCCAAGG - Intronic
1202815824 11_KI270721v1_random:46058-46080 GCTCCTGGGAAGGGGGTGCAGGG - Intergenic
1091831561 12:3554092-3554114 CCACCTGCCCAGGGGCATCATGG + Intronic
1092041948 12:5393074-5393096 CCTCCTGCCCTGTGGCTGTACGG + Intergenic
1093652131 12:21657821-21657843 CCTCCGGCGCCGGCTCTGCAAGG + Intronic
1093687543 12:22073841-22073863 AATCCTGTGCAGGGACTGCATGG + Intronic
1094058392 12:26288422-26288444 CCTCCTGGGCAGAGCCTGCGTGG - Intronic
1094831022 12:34300341-34300363 GGCCCTGCGCAGGGGCTGCTGGG - Intergenic
1094831270 12:34301351-34301373 GGCCCTGCGCAGGGGCTGCTAGG - Intergenic
1094834950 12:34317929-34317951 GGTCCTGCGCAGGGGCTGCTTGG + Intergenic
1094836047 12:34322556-34322578 GGCCCTGCGCAGGGGCTGCTGGG + Intergenic
1095089049 12:38087191-38087213 CCACCTGGGCTGGGGCTGTAGGG + Intergenic
1095097322 12:38155608-38155630 GGCCCGGCGCAGGGGCTGCAGGG - Intergenic
1095953963 12:47796115-47796137 CTACCTGGGCTGGGGCTGCAGGG - Intronic
1100565425 12:95790267-95790289 GCTGCTGCTCTGGGGCTGCACGG - Exonic
1101399197 12:104373324-104373346 CATCCTTCACAGGGGCTGCTGGG - Intergenic
1102304198 12:111792294-111792316 ACGCCAGCGCAGGGCCTGCATGG + Intronic
1102574048 12:113844687-113844709 CTTCCGCCGCAGGGCCTGCAGGG + Exonic
1102895055 12:116592293-116592315 ACTCCAGGGCAGGGGCTGCCCGG + Intergenic
1103444781 12:120987514-120987536 CCTCCTGTTCTGGTGCTGCAGGG + Intronic
1103931096 12:124451495-124451517 CCTCCAGCGCTGGGGCTGAGAGG - Intronic
1104034925 12:125091569-125091591 CATCCTGGGCAGGGGCTGCATGG + Intronic
1104965996 12:132509086-132509108 CCTCCTGGGCCCGGGCTGGACGG + Intronic
1106371306 13:29136492-29136514 TCCCCTGCCCAGAGGCTGCAGGG - Intronic
1108408531 13:50126247-50126269 CCTCCTCCGCAGGTGCAGCGGGG + Intronic
1113486226 13:110654181-110654203 GCTTCTGCCCAGGGGCTCCAGGG - Intronic
1113777851 13:112958861-112958883 CCTCCCGCACAGGGTCTGGATGG + Intronic
1114567118 14:23640807-23640829 GCTGCTCAGCAGGGGCTGCAGGG - Intronic
1114620666 14:24094382-24094404 GCACCTGGGCAGGGGCTGCGGGG - Exonic
1118442095 14:65821441-65821463 CCTGCTGCTCAGGTGGTGCAGGG + Intergenic
1121717310 14:96085418-96085440 CCTCCTGGGCTGGGGCAGGAAGG + Intronic
1121929632 14:97960625-97960647 CCTTCTGCGCTTGGGCTGCCAGG + Intronic
1122350447 14:101086946-101086968 ACACCTGCAAAGGGGCTGCAGGG + Intergenic
1122372268 14:101235344-101235366 CCTCCTGGGCAGGGCCCGCTGGG + Intergenic
1122744451 14:103889626-103889648 TGTCCTGCCCAGGGGCTGTACGG - Intergenic
1122771121 14:104098428-104098450 GCTCCTGAGCAGGGGCCTCAGGG + Intronic
1122827317 14:104376550-104376572 CCTCCTGGGCCGGTGCTCCACGG - Intergenic
1122853066 14:104547140-104547162 CCTCCAGCCCAAGGGCTGGAGGG - Intronic
1122862159 14:104587566-104587588 GCTCCTGGACAGGGACTGCAGGG - Intronic
1123056377 14:105572545-105572567 CCTCCCTCGCTGGGGCTGGAGGG - Intergenic
1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG + Intergenic
1123080812 14:105692673-105692695 CCTCCCTCGCTGGGGCTGGAGGG - Intergenic
1123081831 14:105699195-105699217 CCTCCCTCGCTGGGGCTGGAGGG + Intergenic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1124291766 15:28457611-28457633 CCTGGTGCGCAGGGCCTGCCGGG + Intergenic
1126846450 15:52765045-52765067 TCTCCTGAGCAGGGTTTGCAGGG - Intronic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1129175637 15:73837970-73837992 CTTCCTGGGGAGGAGCTGCAAGG - Intergenic
1129231966 15:74202052-74202074 GCTCCTGGGCAGGGGCTGCTAGG - Intronic
1129391644 15:75223832-75223854 CCCCCTGCAGTGGGGCTGCAGGG + Intergenic
1129472655 15:75764022-75764044 CCCCCTGCAGTGGGGCTGCAGGG - Intergenic
1129895508 15:79102786-79102808 GCACCTAGGCAGGGGCTGCAAGG - Intergenic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1132064391 15:98718565-98718587 CCTCCTCCCCAGGGGCCCCATGG - Intronic
1132332388 15:101021867-101021889 CCTCCTGAGCTGGGGCAGCTGGG + Exonic
1132584645 16:700891-700913 CCTGCTGAGCGGGGGCTGCCGGG - Intronic
1132643505 16:988492-988514 CCCCCTCCCCAGGTGCTGCACGG + Intergenic
1132669099 16:1095424-1095446 CCCCCAGGGCAGGGCCTGCAGGG + Intronic
1132977974 16:2719968-2719990 CCACCTGCTCAGGGGCAGGAGGG + Intronic
1133076165 16:3282911-3282933 CCTGCTGCGCGGGGCCTGCTGGG - Intronic
1133110946 16:3548106-3548128 TGGCCTGCCCAGGGGCTGCAGGG - Intronic
1134042799 16:11081180-11081202 CACCCTGCACCGGGGCTGCAAGG - Intronic
1134124266 16:11605509-11605531 ACTCCTAGGCAGGGGCCGCAAGG + Intronic
1135296379 16:21283128-21283150 CCTCCTCCGCAGGGTCTGTTAGG - Intronic
1136707015 16:32200052-32200074 CCTGGTGCGCAGGGCCTGCCAGG - Intergenic
1136760895 16:32729365-32729387 CCTGGTGCGCAGGGCCTGCCAGG + Intergenic
1136807208 16:33141021-33141043 CCTGGTGCGCAGGGCCTGCCAGG - Intergenic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1140335422 16:74100524-74100546 ACTCCTGCGCAGGGGATGCTGGG - Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141723030 16:85767448-85767470 CCTCCTGCGCCGTGGTTCCACGG - Intergenic
1141765996 16:86060464-86060486 GCCCCTGCGCAGGGGATGAAAGG - Intergenic
1142177345 16:88651218-88651240 CCGCCTGGGCTGGGGCTGCCGGG - Intergenic
1142400437 16:89855702-89855724 CCTCCTCCTCAGGGGCCGCCCGG + Intronic
1203063047 16_KI270728v1_random:989679-989701 CCTGGTGCGCAGGGCCTGCCAGG + Intergenic
1143025784 17:3941357-3941379 CCACCTGCTCAGCTGCTGCAGGG + Intronic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143091403 17:4451025-4451047 CCTCCTGCTTAGGGGCTGGCGGG + Intronic
1143893363 17:10118803-10118825 CCACCTGCGCTGGGCCTGCTTGG - Intronic
1144200591 17:12937974-12937996 CCTCCTGAGCTGGGACTACAGGG - Intronic
1144699185 17:17325689-17325711 CCTCCTGAGCATGACCTGCAGGG + Intronic
1145190802 17:20841503-20841525 CCTGGTGCGCAGGGCCTGCCAGG - Intronic
1146268343 17:31467973-31467995 CCTCCTTCACTGGGGCTGCAGGG - Intronic
1146281700 17:31549405-31549427 CCTCCTTGCCAGGGGCTGCAAGG + Intergenic
1146884968 17:36464553-36464575 CCTCCTGGGCTGGGTCTGCCTGG + Intergenic
1147443646 17:40462144-40462166 CCCTCTTCGCAGGGGCTGCGGGG + Intergenic
1147771614 17:42872136-42872158 CCTCCCTCTGAGGGGCTGCATGG - Intergenic
1149668136 17:58380821-58380843 TCTCCTGCTCAGAGGCTGTAGGG + Intronic
1150056066 17:62017506-62017528 CCTCCTTTTCAGGGGCTACAGGG + Intronic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1150830135 17:68511901-68511923 CCTCCCTTGCAGGGGCTGCGGGG + Intronic
1151309600 17:73285333-73285355 CCTACGGCGCAGGGGCAGCCAGG - Exonic
1151802798 17:76387631-76387653 CCTCCTTCCCTAGGGCTGCAGGG + Exonic
1152276742 17:79362472-79362494 CCACCTGCGCTGGGCCTGGATGG + Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152571125 17:81121721-81121743 GCTCCTGGGCAGAGGCTGCCTGG + Exonic
1154225875 18:12503450-12503472 CCTTCAGCGCCGAGGCTGCACGG + Intronic
1154369102 18:13742211-13742233 CCTCCTGAGCAAGGACTACAGGG - Intronic
1157086205 18:44582448-44582470 ACTTCTGCTCAGGGCCTGCAGGG - Intergenic
1159670085 18:71212340-71212362 GATCCTGCACCGGGGCTGCAGGG + Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160512249 18:79459149-79459171 CCACCTGCGCAGGAATTGCAGGG + Intronic
1160811605 19:1015268-1015290 GCTCCTGCCCAGGGGATGCTTGG + Intronic
1160858423 19:1227585-1227607 GCTCCTGGACACGGGCTGCAGGG - Exonic
1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG + Exonic
1161048543 19:2150321-2150343 CCCACTGCCCAAGGGCTGCACGG + Intronic
1161202692 19:3024831-3024853 CCGCTGGGGCAGGGGCTGCAGGG - Intronic
1161320355 19:3638092-3638114 CCTCCTTCCCAGGGGGTGCAGGG + Intronic
1161507616 19:4652373-4652395 CCACCTGCGCAGGATCTGCGAGG + Exonic
1161580419 19:5077740-5077762 GCCCCTCCGCAGGGGCTGCAGGG + Intronic
1161729218 19:5948709-5948731 AATCCTGTGCAGGGGCTGGAAGG + Intronic
1162106676 19:8373961-8373983 CTGCCTGGGCAGGGGCTCCAAGG + Exonic
1162430881 19:10627710-10627732 TCTGCTCCCCAGGGGCTGCACGG + Exonic
1162480274 19:10923494-10923516 CCTCCTGGCCATGGGCTGTAAGG - Exonic
1162674029 19:12284792-12284814 CCTCGTGCGCAGAGGCTACTGGG + Intronic
1163723557 19:18909994-18910016 ACTCCTGTGCAGAGGCAGCATGG - Intronic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1165013760 19:32866339-32866361 CCTCCTGCTGAGGGACTGCCTGG + Intronic
1165384229 19:35501118-35501140 CCTCTTGCGCTGGGGCTGGGGGG - Intronic
1165450433 19:35879159-35879181 CTTCCTGCGCAGGAGCAGCATGG - Exonic
1166144079 19:40822385-40822407 CCTCCTGCACGTGGGCTGGAGGG + Intronic
1166204440 19:41259871-41259893 CCTCCTGCCCTGGGGCTGCTGGG - Exonic
1166268602 19:41700237-41700259 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268615 19:41700273-41700295 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268628 19:41700309-41700331 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268641 19:41700345-41700367 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268654 19:41700381-41700403 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166789822 19:45392113-45392135 CCTCAAACGCAGGGGCTCCATGG - Exonic
1167244172 19:48363925-48363947 CCTCCTGCGCATGTGCAGGAGGG + Exonic
1167368063 19:49065004-49065026 CCTCCTGCTCGCTGGCTGCAGGG + Intronic
1168147736 19:54429334-54429356 CGTCCTGAGCTGGGGCTCCATGG + Exonic
1168311796 19:55464435-55464457 CCGGGTGCGCCGGGGCTGCAGGG + Intergenic
1168315023 19:55481271-55481293 CCGCCGGGGCAGGGGCCGCAGGG - Exonic
925128468 2:1477812-1477834 GCTCCTGTGCAGGGGCCGAAGGG + Intronic
925200961 2:1967643-1967665 CCTTCTGCGCAGCTGCAGCAGGG + Intronic
926809992 2:16747487-16747509 GGTCCTGAGCAGTGGCTGCAGGG - Intergenic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
932573637 2:72951074-72951096 CCTGGAGGGCAGGGGCTGCAGGG + Intronic
934578099 2:95415768-95415790 CCTCCTGCGCACGGACTGCACGG - Exonic
934601340 2:95660936-95660958 CCTCCTGAGCACGGACTGCACGG + Intergenic
934711117 2:96514829-96514851 CCTCCTGCTCAAGGGCTCCAGGG + Intergenic
934763818 2:96869639-96869661 CCTCCGGCCCCGGGGCTGCGGGG + Intronic
936526078 2:113242353-113242375 CCTCCTGCACAGTGTCAGCAGGG - Intronic
936534710 2:113303104-113303126 CCTCCTGAGCACGGACCGCATGG + Intergenic
937097107 2:119242523-119242545 CCTCCTTCCCCGGGGCTGAAGGG + Intronic
937822366 2:126325367-126325389 GCTCCTGAGCAGGTGCTGCTCGG + Intergenic
937981921 2:127620672-127620694 GCCCCTACGCAGGGTCTGCAGGG + Intronic
945251593 2:207769584-207769606 CCTCCCGCCCAGGTGCTGCCAGG - Intergenic
947716605 2:232342860-232342882 CCACCTGGGGAAGGGCTGCACGG + Intronic
947807343 2:232977745-232977767 CCTCCTGCTCGGGGCCTGCCAGG - Intronic
948179261 2:235966726-235966748 CCTCCTGCGAAGAGGGTGAAGGG - Intronic
1169092651 20:2871097-2871119 CCTCCTTCCCAGGGTCTCCAGGG + Intronic
1169122748 20:3107169-3107191 CCACCTACTCAGGGGCTGGAAGG + Intergenic
1169207631 20:3749140-3749162 CCTCCTGCCCAGGACCTCCATGG - Intronic
1169217589 20:3802434-3802456 CCTCTAGCCCAGGGGCTGCTTGG + Intronic
1170573374 20:17645223-17645245 CTTCCTGCACAGGGGCAGCATGG + Intronic
1171013856 20:21522775-21522797 CCCCCTCCGCTGGGGCTGCGCGG - Intergenic
1173719803 20:45246321-45246343 CCTCCCGTGCAGGGGCTGCTGGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174157891 20:48528512-48528534 CCGCCTGGGCAGCTGCTGCAAGG - Intergenic
1174216802 20:48921979-48922001 CCAGCTGCGCAGGGCCTGCCAGG + Exonic
1174399378 20:50267709-50267731 GCTGCTGAGCAGGGGCGGCAGGG + Intergenic
1175211077 20:57355746-57355768 CCTACAGCACAGGGGCAGCAGGG + Intronic
1176018689 20:62951972-62951994 CCTCCTGGGGAAAGGCTGCATGG + Intergenic
1178939405 21:36892374-36892396 CCGCCAGTGCAGGGGGTGCAGGG + Intronic
1179707984 21:43193622-43193644 CCTCCTGAGGCTGGGCTGCATGG + Intergenic
1179779097 21:43688059-43688081 CCTCCTGCGCTGGGGCAGCGTGG - Exonic
1179785563 21:43727993-43728015 CCAGCTGGGCAGGGGCTGCCAGG - Intronic
1179908772 21:44437270-44437292 CTCCCTGCCCAGGGGCTGCAGGG - Intronic
1179925276 21:44530761-44530783 GCTCCGGGGAAGGGGCTGCAGGG + Intronic
1180055888 21:45359051-45359073 CCGCCTTCCCAGGGCCTGCAGGG - Intergenic
1180067599 21:45420453-45420475 CTACCTGCGTGGGGGCTGCAGGG - Intronic
1181037753 22:20178142-20178164 CCTCCTCCCTTGGGGCTGCAGGG - Intergenic
1181043030 22:20201802-20201824 ACACCTGGGCAGGGGCTGGATGG + Intergenic
1181121475 22:20670460-20670482 CCTGGTGCGCAGGGCCTGCCAGG + Intergenic
1181334434 22:22117484-22117506 CCTGGTGCGCAGGGCCTGCCAGG + Intergenic
1181415935 22:22758793-22758815 CCTCCAGGGAAGGGGCTTCAGGG + Intronic
1181491927 22:23265550-23265572 CCTCCTCCTGTGGGGCTGCACGG + Intronic
1181509260 22:23381753-23381775 CCCCCACGGCAGGGGCTGCAGGG + Intergenic
1182894082 22:33844536-33844558 CCTCTTGCACAGGGGCCCCAAGG - Intronic
1183465535 22:37978397-37978419 ACTCCTCCTCAGGGGCTGCCAGG - Intronic
1183611182 22:38907457-38907479 CCTCCTGCTCAGGGGGTGTTAGG + Intergenic
1184206246 22:43005525-43005547 CCTCCTGCCCTGGCCCTGCATGG - Intronic
1184479737 22:44739303-44739325 CCTCCTGCCCTGGGGCAGGAGGG + Intronic
1184606697 22:45578581-45578603 CCTCCTGCACAGGGGCCTGAAGG - Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
1184771437 22:46599007-46599029 CCTCCTCCGGGGGTGCTGCAGGG - Intronic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1185042879 22:48514576-48514598 CTCCCTGGGCAGGGTCTGCAGGG - Intronic
1185110581 22:48898087-48898109 CCTCCTGTGCTGGGCCCGCAGGG + Intergenic
1185278233 22:49959044-49959066 CCTCCTTCGCAGGTGCTGTGTGG + Intergenic
1185368488 22:50447685-50447707 CCTCCTGGGCTGGGACAGCAAGG - Intronic
950486935 3:13279522-13279544 CATCCTGCCCATGGACTGCATGG + Intergenic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
951208389 3:19947539-19947561 CCTCCTGCGCAGCGGGGGCCTGG + Intronic
952834383 3:37591091-37591113 CCTCCTGCCCCTGGGCTCCAGGG + Intronic
953384567 3:42499270-42499292 CTTCCAGCTCAGGGGCTCCATGG - Intronic
953962827 3:47280373-47280395 ACTCTTGTGCAGGGGCTTCAGGG - Intronic
954808001 3:53231425-53231447 CCTCCTGTGGAGGGGTTGCCAGG + Exonic
957984234 3:87551792-87551814 TCTCCTCCTCAGAGGCTGCAGGG + Intergenic
961117617 3:124344364-124344386 TCTGCTGCGCAGGATCTGCATGG + Intronic
961404513 3:126668724-126668746 CCTGCGGGGCAGGGGCCGCAGGG + Intergenic
961513730 3:127420155-127420177 CCTCCTGCCCATGGGCTGCAGGG - Intergenic
961649978 3:128412471-128412493 CCTCCTGCCAAGGGGCTGCATGG + Intergenic
961662545 3:128477363-128477385 CCTCCTGCTCTGGGGTTGTAGGG + Intergenic
966915810 3:184583654-184583676 GCTCCCGCGCTGGGGCTGCTCGG + Intronic
967007694 3:185399852-185399874 CCTCCAGCAGAGGGGGTGCAGGG - Intronic
968445966 4:652193-652215 GCTGGTGCTCAGGGGCTGCAGGG + Intronic
968642232 4:1720579-1720601 TCTCCTGCGCAGGGCTTGCTGGG - Intronic
968811133 4:2800143-2800165 ACCCCTGCACAGGGGCTACAGGG + Intronic
968874245 4:3256913-3256935 ACTCCTCCCCACGGGCTGCACGG - Intronic
969698300 4:8748317-8748339 CCTCCCACACAGGGCCTGCATGG - Intergenic
969844698 4:9911235-9911257 CCCGCTGCCCAGGGGCTACAGGG + Intronic
971359495 4:25923675-25923697 CCTTTTGGGCAGGGGCAGCAAGG - Intronic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
979122909 4:116926208-116926230 CCTCTCGGGCAGCGGCTGCAGGG + Intergenic
985635286 5:1032911-1032933 CATCCTGCCCAGAGGCTGCGGGG + Intronic
985915028 5:2910986-2911008 CCCCCTGCACAGGTGCTGTATGG - Intergenic
986191010 5:5495810-5495832 CTTCCTGAGCAGGGGGTGCGCGG - Intergenic
986340847 5:6788159-6788181 GAACCTGCCCAGGGGCTGCAGGG + Intergenic
986733201 5:10649851-10649873 TCTCCGCCGCAGGCGCTGCAGGG - Exonic
989405480 5:41056522-41056544 CCTCCTCCTCAGGGACTGTATGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997236030 5:132272353-132272375 CCTCCTGCGCAGGCCATGCATGG + Exonic
997416919 5:133736107-133736129 CCTCCTCGGCATGGTCTGCAAGG - Intergenic
997658688 5:135574026-135574048 CTTCCTTCGCAGGTGCTGGAAGG - Intronic
997935899 5:138110705-138110727 CGTCCTGGGCAGCAGCTGCAGGG - Intergenic
1000483599 5:161810614-161810636 CCTCCGGTGCCAGGGCTGCATGG - Intergenic
1001893904 5:175362504-175362526 CATCCTGAGGAAGGGCTGCATGG + Intergenic
1002029279 5:176416192-176416214 CCGGCTGCGCGGGGGCCGCATGG + Exonic
1002280040 5:178124546-178124568 CCTGTTGGGGAGGGGCTGCAGGG - Exonic
1002448974 5:179308416-179308438 CAGCCTGCCCAGGGGCTGCGCGG - Intronic
1002834402 6:853731-853753 CCTCCTGACCTGGGGGTGCAGGG - Intergenic
1005944627 6:30586284-30586306 CCTCCAGTGCTGGGTCTGCATGG + Exonic
1006020049 6:31112457-31112479 CCTCCTGCCCAAGGGCATCACGG + Intronic
1006305851 6:33218098-33218120 CCTCCTGCACAGAGTCTCCAGGG + Intergenic
1006600101 6:35219597-35219619 AGACCTGGGCAGGGGCTGCAGGG + Intronic
1006809222 6:36809181-36809203 CTCTCTGCGTAGGGGCTGCAAGG - Intronic
1013100368 6:106981343-106981365 CCTCCTGCACAGGGGTGGAAGGG - Intergenic
1014169888 6:118267093-118267115 CATCCTGGGAATGGGCTGCATGG + Exonic
1015799271 6:137044469-137044491 CTTCCAGCCCCGGGGCTGCAGGG - Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1016319961 6:142831667-142831689 CCTCCTGGTCAGGGACTGTAGGG + Intronic
1017019733 6:150130573-150130595 GCTCCTGAGGAGAGGCTGCATGG + Intergenic
1017626669 6:156356382-156356404 CCTCCTCAGGAGGGGCTGCCTGG + Intergenic
1018231797 6:161682534-161682556 CCTCCTGTGGAGGGGCTGCGGGG + Intronic
1018827559 6:167421269-167421291 CCACCCGCCCAGGGGCTCCAGGG - Intergenic
1019033207 6:169031398-169031420 CCTCCTGCCCTGTGGCTGAAGGG + Intergenic
1019309715 7:354057-354079 GCTCCAGGGAAGGGGCTGCAGGG + Intergenic
1019645139 7:2124926-2124948 TCTCCTGCCCTGGGGCTGGAAGG - Intronic
1019795235 7:3043788-3043810 CCGCCCGCCCAGGGGCTGCAGGG + Exonic
1020210560 7:6154894-6154916 GCGCCTGCGCGGGGGCTGCTGGG - Exonic
1022427722 7:30284724-30284746 CCTCCTTCGCAGGGGGAGCGAGG + Exonic
1023991960 7:45133855-45133877 CCTCCTACTCCAGGGCTGCAAGG + Intergenic
1024903002 7:54343688-54343710 CCTCCAGGGCTGGGGCTGGACGG - Intergenic
1025739672 7:64184395-64184417 CCTGCTGCACCCGGGCTGCAGGG + Intronic
1030069166 7:105684006-105684028 ACTCCTGCCCAGGGGCTGCCAGG + Intronic
1034411627 7:150945281-150945303 CCTCCTGAGCAGGGCCTCCAAGG + Exonic
1034460042 7:151193111-151193133 CCCCCACCACAGGGGCTGCAGGG + Intronic
1034545581 7:151786580-151786602 CCTCGGGCCCAGGGGCTGCATGG + Intronic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1036706927 8:11053125-11053147 GCTCCTGCGCAGTGTCTGCGGGG - Intronic
1037817576 8:22120211-22120233 CCGCCGGGGCAGGGGCTTCAGGG - Intronic
1037971884 8:23177812-23177834 GCCCATGGGCAGGGGCTGCAGGG - Intergenic
1037988853 8:23306493-23306515 GCTCCTGCCAAGGGGCTGCCTGG - Intronic
1038639478 8:29311879-29311901 GATCCCGCACAGGGGCTGCAGGG - Intergenic
1039892328 8:41694010-41694032 CTTCCGGCGCCGGGGCTCCACGG + Exonic
1042696159 8:71556898-71556920 CCACCTGCGGAGAGGGTGCAGGG + Intronic
1047215596 8:122873432-122873454 GCACCAGCTCAGGGGCTGCAGGG - Intronic
1049237051 8:141517681-141517703 CCACCTGGGGAGAGGCTGCAGGG - Intronic
1049245025 8:141557800-141557822 CCTGCCGGGGAGGGGCTGCAAGG + Intergenic
1049261047 8:141639393-141639415 CCTCCTGCCCAAGAGCTGCAGGG - Intergenic
1049539919 8:143203717-143203739 CCTCCTGGCCAGGGGCTCCCAGG + Intergenic
1049600203 8:143504067-143504089 CCTCCTTCCCTCGGGCTGCAGGG + Intronic
1049744191 8:144256290-144256312 CCTCCTGGGCAGGTGCGGCATGG - Intronic
1049748413 8:144272649-144272671 CCTCCTGCTTGTGGGCTGCAAGG - Intronic
1052744431 9:32426331-32426353 CCTGCTGCTCAGGGGTTTCACGG - Intronic
1057152948 9:92809918-92809940 CCCCCGCCCCAGGGGCTGCAGGG - Intergenic
1058668659 9:107342472-107342494 TCCCCTGCCCAGGGGCTGCAGGG - Intergenic
1058888733 9:109342926-109342948 CCTGCTGGGCAGGGGTTTCATGG - Intergenic
1059251550 9:112891163-112891185 CCACCGGGGCAGGGGCTGGAAGG + Intergenic
1061365100 9:130168567-130168589 CAGCCTGGGCAGGGGCTTCAGGG - Intergenic
1061365531 9:130171019-130171041 CAGCCTGGGCAGGGGCTTCAGGG + Intergenic
1062005360 9:134236061-134236083 GCTCCTGGGCAGAGCCTGCAGGG - Intergenic
1062206550 9:135340854-135340876 ACAGCTGCACAGGGGCTGCACGG + Intergenic
1062395386 9:136350643-136350665 CCTCCTGGTCAGGGGCTGGGAGG + Intronic
1062600351 9:137316384-137316406 CCTCCTTCCCAGGGGCCGCGGGG + Intronic
1062623675 9:137433702-137433724 CCTCCTGGGTGGGGCCTGCAGGG - Intronic
1185448155 X:269712-269734 CCGCCTGGGCGGGGCCTGCAGGG + Intergenic
1186356661 X:8799036-8799058 CTTCCTGCCCACGGGCTCCATGG + Exonic
1186356990 X:8800151-8800173 CTTCCTGCCCACGGGCTCCATGG + Exonic
1186618788 X:11215636-11215658 CTTCCTGCCCACGGGCTCCATGG - Intronic
1187226012 X:17375867-17375889 CCTCCGGCCCGGCGGCTGCAAGG - Exonic
1189296647 X:39923188-39923210 CGTCCTGCACAGGGGCTGCCAGG + Intergenic
1191250554 X:58258151-58258173 AGCCCTGCGCAGGGGCTGCTGGG - Intergenic
1191252400 X:58265823-58265845 GGCCCTGCGCAGGGGCTGCTGGG + Intergenic
1191253325 X:58269482-58269504 GGCCCTGCGCAGGGGCTGCCGGG + Intergenic
1191254242 X:58272952-58272974 CCTCGGGCGCAGGGGCTGCTGGG + Intergenic
1191257659 X:58286592-58286614 GGTCATGCGCAGGGGCTGCCGGG + Intergenic
1192358764 X:70425628-70425650 CCTCGTGGCCAGGGGCTCCAAGG - Intronic
1196645888 X:118116912-118116934 CCTCCCGCGCAGGCGCCGCCGGG - Intronic
1198099874 X:133414626-133414648 CGTCCTGCGCCCGGGCTGCCTGG + Intronic
1200067769 X:153512377-153512399 CCTGCTGCACAGGGGCAGCCAGG + Intergenic