ID: 1184860693

View in Genome Browser
Species Human (GRCh38)
Location 22:47171733-47171755
Sequence CTGTCAGGCGGTGGTCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184860678_1184860693 20 Left 1184860678 22:47171690-47171712 CCAGCAGCTGTGGATGTGGGCGT 0: 1
1: 0
2: 1
3: 20
4: 179
Right 1184860693 22:47171733-47171755 CTGTCAGGCGGTGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184860693 Original CRISPR CTGTCAGGCGGTGGTCGTGG GGG Intronic
900568635 1:3347548-3347570 CAGTCAGGGGGTGGGGGTGGGGG + Intronic
900980357 1:6042771-6042793 GTGCCAGGCAGTGGTCATGGAGG + Intronic
901681762 1:10916900-10916922 TCCTCAGGCGGTGGTGGTGGAGG - Intergenic
903681614 1:25101204-25101226 CTGTCAGGGGGAGGTTGAGGAGG - Intergenic
904459490 1:30667722-30667744 CTGGCAGGCGGAGGTTGTAGTGG - Intergenic
905364027 1:37439115-37439137 GTGGCAGGTGGTGGTGGTGGGGG - Intergenic
908382749 1:63611962-63611984 CTATCAGGAGCTGGACGTGGTGG + Intronic
910374223 1:86551696-86551718 CTGACAGGCGGTGTTCCTGAAGG - Intronic
912553478 1:110499346-110499368 ATGTCAGGTGGTGGTGGTGGGGG + Intergenic
914771795 1:150693469-150693491 CTTGCAGGCGGTGGGCGAGGGGG + Intronic
914886276 1:151586918-151586940 CTCTCAGGGGCTGGGCGTGGTGG + Intergenic
915217888 1:154352192-154352214 GTGTCAGGTGGTGTTCCTGGCGG - Intergenic
916711633 1:167415779-167415801 CTTGGAGGCGGTGGTGGTGGTGG - Exonic
919281079 1:195489701-195489723 CGGTCAGGTGGTGGTGATGGTGG + Intergenic
924042788 1:239999969-239999991 CTGGGAGGCGGAGGTTGTGGTGG - Intergenic
1064445112 10:15386195-15386217 GTGGCAGGTGGTGGTGGTGGTGG + Intergenic
1066079429 10:31915309-31915331 CCGGGAGGCGGAGGTCGTGGTGG + Intronic
1066106587 10:32162329-32162351 CTGTGTGTCGGTGGTGGTGGTGG - Intergenic
1067057184 10:43059026-43059048 CTGTCAGACGGGGGCCTTGGGGG + Intergenic
1073527205 10:104195163-104195185 CCTTCAGGCAGTGGTCCTGGGGG - Intronic
1076350909 10:129814649-129814671 CTGTCGGGGGGGGGCCGTGGTGG - Intergenic
1076407500 10:130222467-130222489 CTGTCACACAGTGGTCGTGACGG - Intergenic
1077023613 11:430430-430452 CTGTCAGGGGGCGGTGGGGGAGG + Intronic
1077050250 11:563276-563298 CTGTCAGGCCGTGGGGGCGGTGG - Exonic
1078050114 11:7957625-7957647 TTGTGAGGGGGTGGTGGTGGTGG - Intergenic
1078860472 11:15242152-15242174 GTGTCAGGCAGTGGTAGTTGGGG - Intronic
1082006138 11:47420154-47420176 CTGGGAGGTGGTGGTCGTGGAGG + Intronic
1083184194 11:61008013-61008035 CTGGTAGGCGGTGGGGGTGGAGG - Intronic
1083968520 11:66057895-66057917 CTGGGAGGCGGAGGTTGTGGTGG + Intronic
1084056648 11:66638294-66638316 CTGTCTGGCTGTGCACGTGGAGG + Intronic
1088459266 11:110065321-110065343 CTCCCAGGAGGTGGTTGTGGGGG - Intergenic
1089645156 11:119874076-119874098 CTGGGAGGCGGTGGGGGTGGTGG - Intergenic
1090224011 11:125057824-125057846 CAGCCAGGCGGTGGGCGGGGGGG + Intergenic
1090784370 11:130036236-130036258 CTATCAGGGGGTGGGAGTGGGGG + Intergenic
1090832887 11:130431311-130431333 CAGTCAGCAGGTGGTGGTGGTGG - Intergenic
1091235838 11:134021524-134021546 CTGTCAGTCCCTGGTTGTGGGGG - Intergenic
1091317174 11:134622668-134622690 CTGTCATCCAGTGGTCCTGGAGG + Intergenic
1091475700 12:770046-770068 CTGGGAGGCGGAGGTTGTGGTGG - Intronic
1093189100 12:16054813-16054835 CTGTCAGATGGTGGAGGTGGAGG + Intergenic
1096116962 12:49060433-49060455 CAGTCAGCCGGGGGTCGAGGGGG - Intergenic
1096503595 12:52079956-52079978 CTGTCAGGCCCTGGGCGCGGAGG - Intergenic
1097971758 12:65640496-65640518 CTGTCTGGGGGTGGTGATGGTGG - Intergenic
1101763507 12:107678162-107678184 CTGACAGGTGGTGATAGTGGTGG + Intergenic
1102631927 12:114288576-114288598 CTGTGTGGTGGTGGTGGTGGGGG - Intergenic
1102902600 12:116649875-116649897 CTGCCAGGGGGTGGGGGTGGGGG + Intergenic
1104597761 12:130131679-130131701 CTGTGAGGGGGTGGGGGTGGAGG + Intergenic
1105392424 13:19992760-19992782 CTGAAAGGAGGTGGTGGTGGTGG + Intronic
1107300554 13:38961544-38961566 CTGGGAGGTGGTGGTGGTGGTGG - Intergenic
1109175243 13:59147209-59147231 CTGTCAGGGGGTGGGGCTGGGGG + Intergenic
1109540800 13:63776587-63776609 CTGTCAGGAGGTGGGGGGGGGGG - Intergenic
1109964425 13:69672804-69672826 CTGTCAGGGGGTGGGGGTGCTGG + Intergenic
1113461410 13:110484925-110484947 ATGACAGGAGGTGGTCCTGGGGG - Exonic
1114317664 14:21523194-21523216 CTGTCAGGTGGTGGTGGTGGTGG + Exonic
1116491550 14:45509445-45509467 CTGTCAGGGGGTGGGCGTCTAGG - Intergenic
1120669518 14:87348040-87348062 CTTTCAGGGGTTGGTGGTGGTGG - Intergenic
1122937776 14:104967867-104967889 CTGGGAGGCGGTGCTCTTGGCGG - Intronic
1123087196 14:105722178-105722200 CGGGCAGGCCGGGGTCGTGGGGG - Intergenic
1125796790 15:42409294-42409316 CTGCCAGGCTGTGGCTGTGGAGG - Exonic
1125859818 15:42987637-42987659 CTGGGAGGCGGAGGTTGTGGTGG + Intronic
1126180724 15:45782682-45782704 CTGTCAAGAGGTGGGGGTGGGGG - Intergenic
1126473276 15:49039559-49039581 CTGTCACGGGGTGGAGGTGGAGG + Intronic
1128204375 15:65837802-65837824 CTGTGTGGTGGTGGTGGTGGGGG - Intronic
1130028880 15:80294312-80294334 CTGTCAGGGGCCGGGCGTGGTGG - Intergenic
1132096958 15:98993668-98993690 CTGTCAGGCGGTGGGGGGTGGGG + Intronic
1132556405 16:574644-574666 CTGGCAGTCGGAGGGCGTGGAGG + Exonic
1133923941 16:10179702-10179724 CTGTGGGGTGGTGGTGGTGGCGG - Intronic
1138698974 16:58842993-58843015 CTGTTATGCAGTGGTAGTGGGGG + Intergenic
1140573339 16:76134839-76134861 CTGTCGGGCGGTGGTGGGGAGGG - Intergenic
1141738426 16:85871957-85871979 CTGCCAGGCAGTAGGCGTGGAGG - Intergenic
1142312797 16:89323651-89323673 CTGTCAGGCGGTGTGCGGGAGGG - Intronic
1143627904 17:8121635-8121657 CTGTGAGGCGGCGGTGGCGGCGG + Exonic
1146619617 17:34387301-34387323 TTGTCTGCCGGTGGTGGTGGTGG - Intergenic
1147586695 17:41657187-41657209 CTGTAATGCGGGGGTCCTGGTGG + Intergenic
1148460111 17:47834893-47834915 CTGTTTGGTGGTGGTGGTGGTGG + Intronic
1148497170 17:48059884-48059906 CTGTGAGGCAGGGGTGGTGGTGG + Exonic
1150259139 17:63774196-63774218 CCGTGAGGCGGTGGCGGTGGTGG + Exonic
1150604618 17:66680319-66680341 CTGTCAGGCAGGGGTGGAGGTGG + Intronic
1151606268 17:75138481-75138503 CTGGGAGGCGGAGGTTGTGGTGG - Intronic
1151795293 17:76340813-76340835 CTGGGAGGCGGGGGTTGTGGTGG + Intronic
1151981903 17:77517020-77517042 CTCTCATGAGGTGGTCGAGGTGG + Intergenic
1154423318 18:14253002-14253024 CTGTCAGGTGGTGGTCGCTCAGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158436099 18:57436259-57436281 CGGACAGGCGCTGGTGGTGGTGG - Exonic
1162864003 19:13530096-13530118 CTGTCAGGCAGTGGTGGGGAAGG + Intronic
1163068656 19:14819317-14819339 CTGTCAGGGGGTGGGGGTGAGGG - Intronic
1163212828 19:15853923-15853945 CTGTCAGGAGGTGGGGTTGGGGG + Intergenic
1163730772 19:18948046-18948068 CTGCCAGGGGGTGGGAGTGGGGG + Intergenic
1164140294 19:22454194-22454216 CTCTCAGGGGCCGGTCGTGGTGG - Intronic
1165861222 19:38910607-38910629 CTGGCTGGTGGTGGTGGTGGTGG + Exonic
1166530455 19:43539986-43540008 CTGTCAGGGGGTGGGGGTGGGGG + Intergenic
1168296209 19:55378354-55378376 GCGCCAGGCTGTGGTCGTGGGGG + Intergenic
925061276 2:892962-892984 CTGTCTGCCGGTGGCCGTCGTGG - Intergenic
930829902 2:55732143-55732165 CTGGGAGGCGGTGGTTGCGGTGG - Intergenic
931201676 2:60103596-60103618 CTGTAAGGCGGGGGTTGTTGGGG + Intergenic
931525426 2:63147255-63147277 ATTTCAGGAGGTGGTGGTGGTGG + Intronic
932497537 2:72153803-72153825 CTGGCAGGCGGTGGTTTTCGGGG - Intergenic
936608623 2:113980200-113980222 CTGGCAGGCGGTGGTGATGACGG - Intergenic
939411731 2:141835477-141835499 CTGTCAGAAGGTGGTGGTGGGGG + Intronic
939894755 2:147777626-147777648 CTGTAAGGAGGTGGTGGTGGAGG - Intergenic
941065691 2:160900260-160900282 CTGTCAGGGGGTGGGGGTAGGGG - Intergenic
942301209 2:174564133-174564155 CTCTCAGGCTGTGGGCTTGGAGG + Intronic
942474617 2:176306061-176306083 CTGTCAGGGGGTGGGGGTGCTGG - Intronic
944136742 2:196407619-196407641 CTGTCAGGCAGTGGCAGTGCTGG + Intronic
945048901 2:205805390-205805412 GTGGCAGGCGGTGGCAGTGGGGG - Intergenic
945489559 2:210438960-210438982 CAGGCAGGAGGCGGTCGTGGTGG + Intronic
945579856 2:211579792-211579814 CTGTCAGGGGGTGGGGTTGGGGG + Intronic
946419005 2:219554445-219554467 CAGGCAGGCTGTGGTCCTGGAGG + Intronic
947565158 2:231188995-231189017 CTGTTAGCCGGTGGGGGTGGAGG - Intergenic
947714053 2:232331058-232331080 CTGTCAGGCTGGGGTCCTGGAGG + Intronic
947733261 2:232442438-232442460 CTGTCAGGCTGGGGTCCTGGAGG + Intergenic
948176258 2:235945883-235945905 ATGGCTGGCGGTGGTGGTGGGGG + Intronic
948887872 2:240893018-240893040 GTGTCAGGCGGGGGCCGTGTGGG - Intronic
1168979210 20:1990632-1990654 CTTGCAGGCAGTGGTCCTGGTGG + Intronic
1171724241 20:28601908-28601930 ATGTCAGGAGGAGGTCGTAGTGG - Intergenic
1172672681 20:36645175-36645197 ATGGCAGGCGGTGGTGGGGGTGG - Intronic
1173565058 20:44032558-44032580 GTGCCAGGTGGTGGTGGTGGTGG + Intronic
1174148422 20:48468730-48468752 GTGTGAGGAGGTGGTTGTGGAGG - Intergenic
1175394780 20:58650672-58650694 CTGGCAGTCGGGGGTCGTCGGGG - Intergenic
1176023804 20:62975819-62975841 CTGTCATGCAGGGGTCTTGGAGG + Intergenic
1176063161 20:63181040-63181062 CTGCCAGGCAGTGGTCCTGGTGG + Intergenic
1176893330 21:14345822-14345844 CTGGGAGGCGGAGGTTGTGGTGG + Intergenic
1179457132 21:41507703-41507725 CTCCCAGGCGGGGGCCGTGGAGG + Intronic
1179606568 21:42519611-42519633 CTGCCAGGGGGTTGGCGTGGAGG - Intronic
1180170569 21:46056063-46056085 CTGTCAGGCGGTGGGAGGGGAGG - Intergenic
1182298770 22:29326663-29326685 CTGGCAGGCCATGGGCGTGGTGG + Intergenic
1182757337 22:32690639-32690661 ATATCAGGAGGTGGTAGTGGTGG + Intronic
1182801670 22:33036764-33036786 CTGGGAGGCGGAGGTTGTGGTGG - Intronic
1183196941 22:36360060-36360082 ATGTTAGGTGGTGGTGGTGGTGG - Intronic
1183683743 22:39350134-39350156 CTGCCAGGCCGGGGTGGTGGGGG + Intronic
1184248837 22:43249009-43249031 CAGTCAGGGGGTGCTGGTGGAGG + Intronic
1184642555 22:45880192-45880214 CGGTCAGGAGGTGGTCGCGGTGG - Intergenic
1184854590 22:47139451-47139473 TTGTCAGGGGCTGGTCGGGGCGG + Intronic
1184860693 22:47171733-47171755 CTGTCAGGCGGTGGTCGTGGGGG + Intronic
1185284278 22:49993412-49993434 GTTTCCGGCGGTGGTGGTGGAGG + Intergenic
951436884 3:22675885-22675907 CAGTCAGGCGGTGGTCACTGTGG - Intergenic
954113075 3:48446685-48446707 CTGGCAGGCGGAGGGCGCGGAGG - Intergenic
954410749 3:50369897-50369919 GTGTCAGTCGGTGTTCGTGTGGG - Intronic
954811565 3:53251510-53251532 CTGTCAGGAGTTGGGCCTGGAGG - Intronic
954854150 3:53627942-53627964 CTGGGAGGCGGAGGTTGTGGTGG + Intronic
955318734 3:57959369-57959391 CTGTCAGGAGGCGGATGTGGAGG - Intergenic
955460941 3:59182659-59182681 CTGGAAGGCAGTGGTAGTGGTGG + Intergenic
956704533 3:71988031-71988053 CTTCCTGGCGGTGGTAGTGGTGG + Intergenic
956791491 3:72683501-72683523 CTGGCAGGGGGTGGGGGTGGGGG + Intergenic
959619527 3:108385128-108385150 CTTTAAGGTGGTGGTAGTGGGGG + Intronic
960190916 3:114705194-114705216 CTATCAGGCTGTGGTGGTGAGGG - Intronic
960697660 3:120411742-120411764 TTGAGAGGCTGTGGTCGTGGAGG + Intronic
961434398 3:126906604-126906626 GTGTCAGCCGGGGGTCGGGGAGG + Intronic
961752945 3:129107968-129107990 CTGGCAGGCTGTGGGCCTGGGGG - Intronic
962602266 3:137001921-137001943 CTGTCAGGAGGTGGACTTGGGGG - Intronic
963296100 3:143548287-143548309 CTGTCTGGGGGTGGTGGGGGTGG + Intronic
963364912 3:144322963-144322985 TTGTCAGGGGGTGGTAGGGGTGG - Intergenic
963784912 3:149524534-149524556 GTGGCAGGGGGTGGTGGTGGGGG + Intronic
965992567 3:174837717-174837739 CTGGGAGGCGGGGGTTGTGGTGG + Intronic
966449099 3:180037201-180037223 CCGGCAGGCGGTGGTCGCGCTGG + Intergenic
967965469 3:194956912-194956934 CTGTCCGGCCGTGGTGGTGACGG - Intergenic
968807942 4:2787359-2787381 CTGGCAGGGGGTGGTGGTGGGGG + Intergenic
969052930 4:4385957-4385979 CTGTCAGGCGCTGGACGAGGAGG - Exonic
969177582 4:5410576-5410598 CTCCCAGGCTGTGGTCTTGGAGG + Intronic
969713781 4:8858902-8858924 TCGTCACGCGGTGGTGGTGGTGG + Intronic
969834606 4:9830353-9830375 CTATCAGGGGGTTGTGGTGGAGG + Intronic
974758360 4:66242831-66242853 CTGTCATGGGGTGGGCGGGGAGG - Intergenic
977999789 4:103543358-103543380 CTGTTGGGGGGTGGTGGTGGAGG + Intergenic
978325333 4:107547491-107547513 CTGTCGGGGGGTGGGGGTGGGGG - Intergenic
984762035 4:183370891-183370913 CTTGCAGGCGCTGGTCGTGCAGG + Intergenic
984898083 4:184559755-184559777 CTTCCGGGCGGAGGTCGTGGAGG - Intergenic
986098617 5:4584795-4584817 CTGTCAGGAGGGGGACTTGGAGG + Intergenic
990205635 5:53426144-53426166 GTGTGAGGTGGTGGTAGTGGGGG - Intergenic
990214178 5:53512998-53513020 CTGTGAGACTGTGGTGGTGGTGG - Intergenic
990968222 5:61472509-61472531 CTGTAAGGGGGTGGTGGTAGTGG + Intronic
991060825 5:62373923-62373945 GTGTCAGGCTGTGGGTGTGGTGG + Intronic
992274072 5:75096809-75096831 CTGTCATGGGGTGGGGGTGGGGG - Intronic
992461835 5:76967771-76967793 CTGGGAGGCAGTGGTTGTGGTGG - Intronic
995717827 5:115097466-115097488 CTGACAGGCGGTAGAGGTGGTGG + Intergenic
997530493 5:134578763-134578785 CCGTCCTGCGGTGGTGGTGGTGG - Exonic
997675077 5:135706835-135706857 CTGTCAGGCAGTGGTGGGTGAGG + Intergenic
998566075 5:143216975-143216997 CTGTCAGGCGGTGGGTGGGGTGG + Intronic
1001289712 5:170448225-170448247 CTGCCAGGCAGTGATAGTGGGGG - Intronic
1001290720 5:170457319-170457341 CTGACATGTGGTGGTGGTGGTGG - Intronic
1001468927 5:171994712-171994734 CAGTCTGGTGGTGGTGGTGGTGG - Intronic
1001692128 5:173641145-173641167 TTGCCAGGTGGTGGGCGTGGGGG + Intergenic
1002884595 6:1282210-1282232 CTGGTCGGCGGTGGGCGTGGGGG - Intergenic
1003530032 6:6929430-6929452 CTGGCAGGGGATGGTGGTGGAGG - Intergenic
1003869615 6:10391238-10391260 CTGTCTGGCGTTGGGCGTGGGGG - Intergenic
1006478371 6:34272624-34272646 CTGTCAGGGGCTGGTCGGTGAGG - Intergenic
1008044765 6:46840489-46840511 CTGTGAGGTGGAGGTTGTGGGGG - Intergenic
1009268578 6:61589061-61589083 CTGTCAGGGGGTGGGGGTAGGGG + Intergenic
1012411036 6:98957294-98957316 CTGTCAGGGGGTGGGGGTGTTGG + Intergenic
1013422506 6:109979142-109979164 CTCCCAGGTGGTGGTAGTGGCGG + Exonic
1014807677 6:125848644-125848666 CTGTCGGGGGGTGGTGGTTGGGG + Intronic
1016808652 6:148238296-148238318 CTGGGAGGCGGAGGTTGTGGTGG - Intergenic
1018020529 6:159759132-159759154 CTGGGAGGCGGAGGTTGTGGTGG - Intronic
1018893088 6:167996342-167996364 CTGTGAGTCCTTGGTCGTGGTGG + Intronic
1019593447 7:1847329-1847351 ATGGCAGGCGGTGCTCGCGGAGG + Exonic
1019677084 7:2320278-2320300 CTGGGAGGCGGAGGTTGTGGGGG + Intronic
1019783840 7:2960839-2960861 TTGTAAGGTGGTGGTGGTGGTGG - Intronic
1022960163 7:35418836-35418858 CTCTCTGGTGGTGGTGGTGGTGG + Intergenic
1023818227 7:43966095-43966117 CTGGCAGACGGTGGAGGTGGGGG + Intergenic
1024129382 7:46335148-46335170 CTGTCAGGGGGTGGGGGTTGGGG - Intergenic
1025077565 7:55956195-55956217 CTGGGAGGCGGAGGTCGTGGTGG - Exonic
1028601691 7:92607736-92607758 CTGTCAGGTGCTGTTCCTGGGGG + Exonic
1029196780 7:98810979-98811001 GTGTCTGGCAGTGGTGGTGGTGG + Intergenic
1029472617 7:100764128-100764150 CTGGCAGGTGGTGGTCATGGTGG - Exonic
1029742855 7:102500927-102500949 CTGGCAGACGGTGGAGGTGGGGG + Intronic
1029760845 7:102600088-102600110 CTGGCAGACGGTGGAGGTGGGGG + Intronic
1029807265 7:103010337-103010359 CTGTCTGCTGGTGGTGGTGGTGG - Intronic
1032192013 7:129770825-129770847 CTGTCAGGTGCTGGGAGTGGAGG - Intergenic
1033788881 7:144767852-144767874 CTTACAGGTGGTGGTGGTGGTGG - Intronic
1035013268 7:155739885-155739907 CGGACAGGTGGTGGTGGTGGTGG - Exonic
1035982048 8:4383295-4383317 ATGTTAGGCGGTGGGCATGGGGG + Intronic
1037751578 8:21685819-21685841 CTGGCAGGGGCTGGGCGTGGTGG - Intergenic
1038768863 8:30457357-30457379 CTGAAAGGTGGTGGTCATGGTGG + Intronic
1039762995 8:40598359-40598381 CTGTCAGGGGGTGGGGGTGAGGG - Intronic
1044561532 8:93617375-93617397 CTGGCAGGAGGTGGGCCTGGTGG + Intergenic
1044596482 8:93963977-93963999 CTGTCAGGGGGTGGGGGTGCTGG - Intergenic
1046522657 8:115345337-115345359 ATGTCTGTCGGTGGTAGTGGTGG - Intergenic
1052451000 9:28631305-28631327 CTGTCATGGGGTGGGGGTGGGGG - Intronic
1052656789 9:31373666-31373688 CTGTCATGGGGTGGGGGTGGAGG - Intergenic
1053652793 9:40186240-40186262 CTGTGAGGTGGGGGTTGTGGGGG + Intergenic
1053903197 9:42815547-42815569 CTGTGAGGTGGGGGTTGTGGGGG + Intergenic
1054531788 9:66189981-66190003 CTGTGAGGTGGGGGTTGTGGGGG - Intergenic
1055584760 9:77746887-77746909 CTATCAGGAGGTGGTGGTGATGG + Intronic
1059952104 9:119476778-119476800 CTGTCATGGGGTGGTGGTTGGGG + Intergenic
1060749156 9:126157491-126157513 CTGGGAGGGGGTGGTGGTGGGGG - Intergenic
1062192365 9:135254601-135254623 CAGACAGGCGGTGGTCTGGGTGG - Intergenic
1062600002 9:137315376-137315398 CTCTCCGGCGGTGGCGGTGGGGG - Intronic
1186646995 X:11517813-11517835 CTGTCAGGTGGTGGGGTTGGGGG + Intronic
1188004178 X:25005855-25005877 CTCCAAGGCGGTGGGCGTGGGGG - Intronic
1188255683 X:27959971-27959993 CTGTCGGGGGGTGGGGGTGGGGG - Intergenic
1189253538 X:39620003-39620025 TTGTGGGGCGGTGGTGGTGGAGG - Intergenic
1192467309 X:71366493-71366515 ATGTGAGGGGGTGGGCGTGGGGG + Exonic
1193194242 X:78611154-78611176 TTGTCAGGGGGTGGGGGTGGAGG - Intergenic
1193649869 X:84117936-84117958 GTGGCAGGGGGTGGTGGTGGTGG - Intronic
1196092979 X:111766698-111766720 CTGTCATGGGGTGGGGGTGGGGG - Intergenic
1197266169 X:124374610-124374632 CTGTCAGGCGGTGGGCGGCAAGG - Intronic
1197753406 X:129980401-129980423 CCGTGAGGCGGGGGTGGTGGGGG + Intergenic