ID: 1184862395

View in Genome Browser
Species Human (GRCh38)
Location 22:47180450-47180472
Sequence GTTGCAAGCCACTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184862395_1184862403 12 Left 1184862395 22:47180450-47180472 CCCACCCCACAGTGGCTTGCAAC No data
Right 1184862403 22:47180485-47180507 TCTGCTCATCTGGTTTTCTTTGG No data
1184862395_1184862402 2 Left 1184862395 22:47180450-47180472 CCCACCCCACAGTGGCTTGCAAC No data
Right 1184862402 22:47180475-47180497 TGGCTGCAGGTCTGCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184862395 Original CRISPR GTTGCAAGCCACTGTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr