ID: 1184864054

View in Genome Browser
Species Human (GRCh38)
Location 22:47192765-47192787
Sequence GCAAGAGGGGAACTGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864054_1184864071 27 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864054_1184864067 18 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864054_1184864056 -10 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864054_1184864066 17 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864054 Original CRISPR GCAAGAGGGGAACTGCAGAC AGG (reversed) Intergenic