ID: 1184864055

View in Genome Browser
Species Human (GRCh38)
Location 22:47192778-47192800
Sequence CCGGGGCAGGCGGGCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864055_1184864067 5 Left 1184864055 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864055_1184864066 4 Left 1184864055 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data
1184864055_1184864071 14 Left 1184864055 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864055 Original CRISPR CCGGGGCAGGCGGGCAAGAG GGG (reversed) Intergenic