ID: 1184864056

View in Genome Browser
Species Human (GRCh38)
Location 22:47192778-47192800
Sequence CCCCTCTTGCCCGCCTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864053_1184864056 3 Left 1184864053 22:47192752-47192774 CCTGGATGTGTGGCCTGTCTGCA No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864046_1184864056 23 Left 1184864046 22:47192732-47192754 CCCTGGTGCTCACTCCTACCCCT No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864052_1184864056 4 Left 1184864052 22:47192751-47192773 CCCTGGATGTGTGGCCTGTCTGC No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864047_1184864056 22 Left 1184864047 22:47192733-47192755 CCTGGTGCTCACTCCTACCCCTG No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864050_1184864056 9 Left 1184864050 22:47192746-47192768 CCTACCCCTGGATGTGTGGCCTG 0: 1
1: 0
2: 1
3: 25
4: 302
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864054_1184864056 -10 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
1184864051_1184864056 5 Left 1184864051 22:47192750-47192772 CCCCTGGATGTGTGGCCTGTCTG No data
Right 1184864056 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864056 Original CRISPR CCCCTCTTGCCCGCCTGCCC CGG Intergenic