ID: 1184864057 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:47192779-47192801 |
| Sequence | TCCGGGGCAGGCGGGCAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184864057_1184864066 | 3 | Left | 1184864057 | 22:47192779-47192801 | CCCTCTTGCCCGCCTGCCCCGGA | No data | ||
| Right | 1184864066 | 22:47192805-47192827 | GTCCCCTGCATTCTAATTGCCGG | 0: 1 1: 0 2: 0 3: 6 4: 85 |
||||
| 1184864057_1184864071 | 13 | Left | 1184864057 | 22:47192779-47192801 | CCCTCTTGCCCGCCTGCCCCGGA | No data | ||
| Right | 1184864071 | 22:47192815-47192837 | TTCTAATTGCCGGGACCCAGCGG | 0: 1 1: 0 2: 0 3: 4 4: 74 |
||||
| 1184864057_1184864067 | 4 | Left | 1184864057 | 22:47192779-47192801 | CCCTCTTGCCCGCCTGCCCCGGA | No data | ||
| Right | 1184864067 | 22:47192806-47192828 | TCCCCTGCATTCTAATTGCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184864057 | Original CRISPR | TCCGGGGCAGGCGGGCAAGA GGG (reversed) | Intergenic | ||