ID: 1184864058

View in Genome Browser
Species Human (GRCh38)
Location 22:47192780-47192802
Sequence GTCCGGGGCAGGCGGGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864058_1184864066 2 Left 1184864058 22:47192780-47192802 CCTCTTGCCCGCCTGCCCCGGAC No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data
1184864058_1184864071 12 Left 1184864058 22:47192780-47192802 CCTCTTGCCCGCCTGCCCCGGAC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864058_1184864067 3 Left 1184864058 22:47192780-47192802 CCTCTTGCCCGCCTGCCCCGGAC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864058 Original CRISPR GTCCGGGGCAGGCGGGCAAG AGG (reversed) Intergenic