ID: 1184864059

View in Genome Browser
Species Human (GRCh38)
Location 22:47192787-47192809
Sequence GGGACTGGTCCGGGGCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864059_1184864071 5 Left 1184864059 22:47192787-47192809 CCCGCCTGCCCCGGACCAGTCCC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864059_1184864066 -5 Left 1184864059 22:47192787-47192809 CCCGCCTGCCCCGGACCAGTCCC No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data
1184864059_1184864067 -4 Left 1184864059 22:47192787-47192809 CCCGCCTGCCCCGGACCAGTCCC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864059 Original CRISPR GGGACTGGTCCGGGGCAGGC GGG (reversed) Intergenic