ID: 1184864060 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:47192788-47192810 |
Sequence | GGGGACTGGTCCGGGGCAGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1184864060_1184864071 | 4 | Left | 1184864060 | 22:47192788-47192810 | CCGCCTGCCCCGGACCAGTCCCC | No data | ||
Right | 1184864071 | 22:47192815-47192837 | TTCTAATTGCCGGGACCCAGCGG | 0: 1 1: 0 2: 0 3: 4 4: 74 |
||||
1184864060_1184864066 | -6 | Left | 1184864060 | 22:47192788-47192810 | CCGCCTGCCCCGGACCAGTCCCC | No data | ||
Right | 1184864066 | 22:47192805-47192827 | GTCCCCTGCATTCTAATTGCCGG | 0: 1 1: 0 2: 0 3: 6 4: 85 |
||||
1184864060_1184864067 | -5 | Left | 1184864060 | 22:47192788-47192810 | CCGCCTGCCCCGGACCAGTCCCC | No data | ||
Right | 1184864067 | 22:47192806-47192828 | TCCCCTGCATTCTAATTGCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1184864060 | Original CRISPR | GGGGACTGGTCCGGGGCAGG CGG (reversed) | Intergenic | ||