ID: 1184864060

View in Genome Browser
Species Human (GRCh38)
Location 22:47192788-47192810
Sequence GGGGACTGGTCCGGGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864060_1184864071 4 Left 1184864060 22:47192788-47192810 CCGCCTGCCCCGGACCAGTCCCC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864060_1184864067 -5 Left 1184864060 22:47192788-47192810 CCGCCTGCCCCGGACCAGTCCCC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864060_1184864066 -6 Left 1184864060 22:47192788-47192810 CCGCCTGCCCCGGACCAGTCCCC No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864060 Original CRISPR GGGGACTGGTCCGGGGCAGG CGG (reversed) Intergenic