ID: 1184864061

View in Genome Browser
Species Human (GRCh38)
Location 22:47192791-47192813
Sequence GCAGGGGACTGGTCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864061_1184864077 29 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data
1184864061_1184864066 -9 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864066 22:47192805-47192827 GTCCCCTGCATTCTAATTGCCGG No data
1184864061_1184864076 28 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864061_1184864071 1 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864061_1184864067 -8 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864061 Original CRISPR GCAGGGGACTGGTCCGGGGC AGG (reversed) Intergenic