ID: 1184864064

View in Genome Browser
Species Human (GRCh38)
Location 22:47192797-47192819
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864064_1184864076 22 Left 1184864064 22:47192797-47192819 CCGGACCAGTCCCCTGCATTCTA No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864064_1184864071 -5 Left 1184864064 22:47192797-47192819 CCGGACCAGTCCCCTGCATTCTA No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1184864064_1184864077 23 Left 1184864064 22:47192797-47192819 CCGGACCAGTCCCCTGCATTCTA No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864064 Original CRISPR TAGAATGCAGGGGACTGGTC CGG (reversed) Intergenic