ID: 1184864067

View in Genome Browser
Species Human (GRCh38)
Location 22:47192806-47192828
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864058_1184864067 3 Left 1184864058 22:47192780-47192802 CCTCTTGCCCGCCTGCCCCGGAC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864055_1184864067 5 Left 1184864055 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864061_1184864067 -8 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864060_1184864067 -5 Left 1184864060 22:47192788-47192810 CCGCCTGCCCCGGACCAGTCCCC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864059_1184864067 -4 Left 1184864059 22:47192787-47192809 CCCGCCTGCCCCGGACCAGTCCC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864057_1184864067 4 Left 1184864057 22:47192779-47192801 CCCTCTTGCCCGCCTGCCCCGGA No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data
1184864054_1184864067 18 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864067 22:47192806-47192828 TCCCCTGCATTCTAATTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864067 Original CRISPR TCCCCTGCATTCTAATTGCC GGG Intergenic