ID: 1184864069

View in Genome Browser
Species Human (GRCh38)
Location 22:47192808-47192830
Sequence GTCCCGGCAATTAGAATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864069_1184864076 11 Left 1184864069 22:47192808-47192830 CCCTGCATTCTAATTGCCGGGAC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864069_1184864077 12 Left 1184864069 22:47192808-47192830 CCCTGCATTCTAATTGCCGGGAC No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864069 Original CRISPR GTCCCGGCAATTAGAATGCA GGG (reversed) Intergenic