ID: 1184864070

View in Genome Browser
Species Human (GRCh38)
Location 22:47192809-47192831
Sequence GGTCCCGGCAATTAGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864070_1184864076 10 Left 1184864070 22:47192809-47192831 CCTGCATTCTAATTGCCGGGACC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864070_1184864077 11 Left 1184864070 22:47192809-47192831 CCTGCATTCTAATTGCCGGGACC No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864070 Original CRISPR GGTCCCGGCAATTAGAATGC AGG (reversed) Intergenic