ID: 1184864071

View in Genome Browser
Species Human (GRCh38)
Location 22:47192815-47192837
Sequence TTCTAATTGCCGGGACCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864061_1184864071 1 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864059_1184864071 5 Left 1184864059 22:47192787-47192809 CCCGCCTGCCCCGGACCAGTCCC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864055_1184864071 14 Left 1184864055 22:47192778-47192800 CCCCTCTTGCCCGCCTGCCCCGG No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864063_1184864071 -4 Left 1184864063 22:47192796-47192818 CCCGGACCAGTCCCCTGCATTCT No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864064_1184864071 -5 Left 1184864064 22:47192797-47192819 CCGGACCAGTCCCCTGCATTCTA No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864060_1184864071 4 Left 1184864060 22:47192788-47192810 CCGCCTGCCCCGGACCAGTCCCC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864062_1184864071 -3 Left 1184864062 22:47192795-47192817 CCCCGGACCAGTCCCCTGCATTC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864057_1184864071 13 Left 1184864057 22:47192779-47192801 CCCTCTTGCCCGCCTGCCCCGGA No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864058_1184864071 12 Left 1184864058 22:47192780-47192802 CCTCTTGCCCGCCTGCCCCGGAC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864065_1184864071 -10 Left 1184864065 22:47192802-47192824 CCAGTCCCCTGCATTCTAATTGC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data
1184864054_1184864071 27 Left 1184864054 22:47192765-47192787 CCTGTCTGCAGTTCCCCTCTTGC No data
Right 1184864071 22:47192815-47192837 TTCTAATTGCCGGGACCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864071 Original CRISPR TTCTAATTGCCGGGACCCAG CGG Intergenic