ID: 1184864072

View in Genome Browser
Species Human (GRCh38)
Location 22:47192824-47192846
Sequence TGCGGACAGCCGCTGGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864072_1184864077 -4 Left 1184864072 22:47192824-47192846 CCGGGACCCAGCGGCTGTCCGCA No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data
1184864072_1184864076 -5 Left 1184864072 22:47192824-47192846 CCGGGACCCAGCGGCTGTCCGCA No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864072_1184864085 18 Left 1184864072 22:47192824-47192846 CCGGGACCCAGCGGCTGTCCGCA No data
Right 1184864085 22:47192865-47192887 GCTCCTCCCTCTGCCCGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864072 Original CRISPR TGCGGACAGCCGCTGGGTCC CGG (reversed) Intergenic