ID: 1184864073

View in Genome Browser
Species Human (GRCh38)
Location 22:47192830-47192852
Sequence GGGGGGTGCGGACAGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864073_1184864085 12 Left 1184864073 22:47192830-47192852 CCCAGCGGCTGTCCGCACCCCCC No data
Right 1184864085 22:47192865-47192887 GCTCCTCCCTCTGCCCGTAAAGG No data
1184864073_1184864090 25 Left 1184864073 22:47192830-47192852 CCCAGCGGCTGTCCGCACCCCCC No data
Right 1184864090 22:47192878-47192900 CCCGTAAAGGCTTCTGTATCTGG No data
1184864073_1184864077 -10 Left 1184864073 22:47192830-47192852 CCCAGCGGCTGTCCGCACCCCCC No data
Right 1184864077 22:47192843-47192865 CGCACCCCCCACCTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864073 Original CRISPR GGGGGGTGCGGACAGCCGCT GGG (reversed) Intergenic