ID: 1184864076

View in Genome Browser
Species Human (GRCh38)
Location 22:47192842-47192864
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184864065_1184864076 17 Left 1184864065 22:47192802-47192824 CCAGTCCCCTGCATTCTAATTGC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864068_1184864076 12 Left 1184864068 22:47192807-47192829 CCCCTGCATTCTAATTGCCGGGA No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864069_1184864076 11 Left 1184864069 22:47192808-47192830 CCCTGCATTCTAATTGCCGGGAC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864070_1184864076 10 Left 1184864070 22:47192809-47192831 CCTGCATTCTAATTGCCGGGACC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864072_1184864076 -5 Left 1184864072 22:47192824-47192846 CCGGGACCCAGCGGCTGTCCGCA No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864064_1184864076 22 Left 1184864064 22:47192797-47192819 CCGGACCAGTCCCCTGCATTCTA No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864062_1184864076 24 Left 1184864062 22:47192795-47192817 CCCCGGACCAGTCCCCTGCATTC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864063_1184864076 23 Left 1184864063 22:47192796-47192818 CCCGGACCAGTCCCCTGCATTCT No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data
1184864061_1184864076 28 Left 1184864061 22:47192791-47192813 CCTGCCCCGGACCAGTCCCCTGC No data
Right 1184864076 22:47192842-47192864 CCGCACCCCCCACCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184864076 Original CRISPR CCGCACCCCCCACCTCTGCC TGG Intergenic