ID: 1184869812

View in Genome Browser
Species Human (GRCh38)
Location 22:47229791-47229813
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184869811_1184869812 29 Left 1184869811 22:47229739-47229761 CCAAAGCTCTAATTTTCACAAGA No data
Right 1184869812 22:47229791-47229813 GTTGTTTTCCTTGCAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184869812 Original CRISPR GTTGTTTTCCTTGCAATGAC AGG Intergenic
No off target data available for this crispr