ID: 1184874339

View in Genome Browser
Species Human (GRCh38)
Location 22:47263653-47263675
Sequence GGTTAGCCAGGGGACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184874328_1184874339 29 Left 1184874328 22:47263601-47263623 CCTTCTAGTCCCTGGTGAGAACA No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data
1184874329_1184874339 20 Left 1184874329 22:47263610-47263632 CCCTGGTGAGAACACCGTGTGCA No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data
1184874331_1184874339 6 Left 1184874331 22:47263624-47263646 CCGTGTGCATTCATCCTGAGTGG No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data
1184874327_1184874339 30 Left 1184874327 22:47263600-47263622 CCCTTCTAGTCCCTGGTGAGAAC No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data
1184874330_1184874339 19 Left 1184874330 22:47263611-47263633 CCTGGTGAGAACACCGTGTGCAT No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data
1184874334_1184874339 -8 Left 1184874334 22:47263638-47263660 CCTGAGTGGCTGCTTGGTTAGCC No data
Right 1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184874339 Original CRISPR GGTTAGCCAGGGGACTTTGG TGG Intergenic
No off target data available for this crispr