ID: 1184876753

View in Genome Browser
Species Human (GRCh38)
Location 22:47281149-47281171
Sequence TCCAGTCCATGGAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184876753_1184876761 8 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876761 22:47281180-47281202 CTCGGGCTGTTCTAAGAAATGGG No data
1184876753_1184876758 -10 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876758 22:47281162-47281184 ATGGACTGGAGTCTGAGACTCGG No data
1184876753_1184876763 26 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876763 22:47281198-47281220 ATGGGCAGTTTTTGTCTGGAAGG No data
1184876753_1184876759 -9 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876759 22:47281163-47281185 TGGACTGGAGTCTGAGACTCGGG No data
1184876753_1184876760 7 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876760 22:47281179-47281201 ACTCGGGCTGTTCTAAGAAATGG No data
1184876753_1184876762 22 Left 1184876753 22:47281149-47281171 CCCCCAGGACTCCATGGACTGGA No data
Right 1184876762 22:47281194-47281216 AGAAATGGGCAGTTTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184876753 Original CRISPR TCCAGTCCATGGAGTCCTGG GGG (reversed) Intergenic