ID: 1184877068

View in Genome Browser
Species Human (GRCh38)
Location 22:47282725-47282747
Sequence CAGAGTAAGCTGGAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184877068_1184877079 9 Left 1184877068 22:47282725-47282747 CCCCCAGCCTCCAGCTTACTCTG No data
Right 1184877079 22:47282757-47282779 CCGTCGCGACTCTGTCTTCTGGG No data
1184877068_1184877082 27 Left 1184877068 22:47282725-47282747 CCCCCAGCCTCCAGCTTACTCTG No data
Right 1184877082 22:47282775-47282797 CTGGGGTCTGACCTGTTCCTGGG No data
1184877068_1184877077 8 Left 1184877068 22:47282725-47282747 CCCCCAGCCTCCAGCTTACTCTG No data
Right 1184877077 22:47282756-47282778 GCCGTCGCGACTCTGTCTTCTGG No data
1184877068_1184877081 26 Left 1184877068 22:47282725-47282747 CCCCCAGCCTCCAGCTTACTCTG No data
Right 1184877081 22:47282774-47282796 TCTGGGGTCTGACCTGTTCCTGG No data
1184877068_1184877080 10 Left 1184877068 22:47282725-47282747 CCCCCAGCCTCCAGCTTACTCTG No data
Right 1184877080 22:47282758-47282780 CGTCGCGACTCTGTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184877068 Original CRISPR CAGAGTAAGCTGGAGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr