ID: 1184878345

View in Genome Browser
Species Human (GRCh38)
Location 22:47289530-47289552
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878345_1184878355 7 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878355 22:47289560-47289582 TGGGCTGTGGGCTGGTCTGGTGG No data
1184878345_1184878349 -6 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878349 22:47289547-47289569 TGATGATACCCTCTGGGCTGTGG No data
1184878345_1184878356 8 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878356 22:47289561-47289583 GGGCTGTGGGCTGGTCTGGTGGG No data
1184878345_1184878354 4 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878354 22:47289557-47289579 CTCTGGGCTGTGGGCTGGTCTGG No data
1184878345_1184878361 30 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878361 22:47289583-47289605 GCTCAGGACTGGCAGAGGCTGGG No data
1184878345_1184878359 25 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878359 22:47289578-47289600 GGTGGGCTCAGGACTGGCAGAGG No data
1184878345_1184878357 14 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878357 22:47289567-47289589 TGGGCTGGTCTGGTGGGCTCAGG No data
1184878345_1184878351 -1 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878351 22:47289552-47289574 ATACCCTCTGGGCTGTGGGCTGG No data
1184878345_1184878350 -5 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878350 22:47289548-47289570 GATGATACCCTCTGGGCTGTGGG No data
1184878345_1184878360 29 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878345_1184878358 19 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878358 22:47289572-47289594 TGGTCTGGTGGGCTCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878345 Original CRISPR TCATCAGCCACCTGCAGGCA TGG (reversed) Intergenic