ID: 1184878349 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:47289547-47289569 |
| Sequence | TGATGATACCCTCTGGGCTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184878345_1184878349 | -6 | Left | 1184878345 | 22:47289530-47289552 | CCATGCCTGCAGGTGGCTGATGA | No data | ||
| Right | 1184878349 | 22:47289547-47289569 | TGATGATACCCTCTGGGCTGTGG | No data | ||||
| 1184878342_1184878349 | 12 | Left | 1184878342 | 22:47289512-47289534 | CCAAGAGATCAGCTCTGGCCATG | No data | ||
| Right | 1184878349 | 22:47289547-47289569 | TGATGATACCCTCTGGGCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184878349 | Original CRISPR | TGATGATACCCTCTGGGCTG TGG | Intergenic | ||