ID: 1184878352

View in Genome Browser
Species Human (GRCh38)
Location 22:47289555-47289577
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878352_1184878363 21 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878363 22:47289599-47289621 GGCTGGGCTTGGAGCTGAAGTGG No data
1184878352_1184878361 5 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878361 22:47289583-47289605 GCTCAGGACTGGCAGAGGCTGGG No data
1184878352_1184878358 -6 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878358 22:47289572-47289594 TGGTCTGGTGGGCTCAGGACTGG No data
1184878352_1184878364 22 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878364 22:47289600-47289622 GCTGGGCTTGGAGCTGAAGTGGG No data
1184878352_1184878366 27 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878366 22:47289605-47289627 GCTTGGAGCTGAAGTGGGGAAGG No data
1184878352_1184878362 10 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878362 22:47289588-47289610 GGACTGGCAGAGGCTGGGCTTGG No data
1184878352_1184878365 23 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878365 22:47289601-47289623 CTGGGCTTGGAGCTGAAGTGGGG 0: 1
1: 0
2: 1
3: 29
4: 323
1184878352_1184878360 4 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878352_1184878359 0 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878359 22:47289578-47289600 GGTGGGCTCAGGACTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878352 Original CRISPR AGACCAGCCCACAGCCCAGA GGG (reversed) Intergenic