ID: 1184878353

View in Genome Browser
Species Human (GRCh38)
Location 22:47289556-47289578
Sequence CAGACCAGCCCACAGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878353_1184878364 21 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878364 22:47289600-47289622 GCTGGGCTTGGAGCTGAAGTGGG No data
1184878353_1184878362 9 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878362 22:47289588-47289610 GGACTGGCAGAGGCTGGGCTTGG No data
1184878353_1184878363 20 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878363 22:47289599-47289621 GGCTGGGCTTGGAGCTGAAGTGG No data
1184878353_1184878361 4 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878361 22:47289583-47289605 GCTCAGGACTGGCAGAGGCTGGG No data
1184878353_1184878367 30 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878367 22:47289609-47289631 GGAGCTGAAGTGGGGAAGGTAGG No data
1184878353_1184878358 -7 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878358 22:47289572-47289594 TGGTCTGGTGGGCTCAGGACTGG No data
1184878353_1184878359 -1 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878359 22:47289578-47289600 GGTGGGCTCAGGACTGGCAGAGG No data
1184878353_1184878365 22 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878365 22:47289601-47289623 CTGGGCTTGGAGCTGAAGTGGGG No data
1184878353_1184878360 3 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878353_1184878366 26 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878366 22:47289605-47289627 GCTTGGAGCTGAAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878353 Original CRISPR CAGACCAGCCCACAGCCCAG AGG (reversed) Intergenic
No off target data available for this crispr