ID: 1184878360

View in Genome Browser
Species Human (GRCh38)
Location 22:47289582-47289604
Sequence GGCTCAGGACTGGCAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878352_1184878360 4 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878345_1184878360 29 Left 1184878345 22:47289530-47289552 CCATGCCTGCAGGTGGCTGATGA No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878346_1184878360 24 Left 1184878346 22:47289535-47289557 CCTGCAGGTGGCTGATGATACCC No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data
1184878353_1184878360 3 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878360 Original CRISPR GGCTCAGGACTGGCAGAGGC TGG Intergenic
No off target data available for this crispr