ID: 1184878364

View in Genome Browser
Species Human (GRCh38)
Location 22:47289600-47289622
Sequence GCTGGGCTTGGAGCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878353_1184878364 21 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878364 22:47289600-47289622 GCTGGGCTTGGAGCTGAAGTGGG No data
1184878352_1184878364 22 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878364 22:47289600-47289622 GCTGGGCTTGGAGCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878364 Original CRISPR GCTGGGCTTGGAGCTGAAGT GGG Intergenic
No off target data available for this crispr