ID: 1184878365

View in Genome Browser
Species Human (GRCh38)
Location 22:47289601-47289623
Sequence CTGGGCTTGGAGCTGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878352_1184878365 23 Left 1184878352 22:47289555-47289577 CCCTCTGGGCTGTGGGCTGGTCT No data
Right 1184878365 22:47289601-47289623 CTGGGCTTGGAGCTGAAGTGGGG No data
1184878353_1184878365 22 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878365 22:47289601-47289623 CTGGGCTTGGAGCTGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878365 Original CRISPR CTGGGCTTGGAGCTGAAGTG GGG Intergenic
No off target data available for this crispr