ID: 1184878367

View in Genome Browser
Species Human (GRCh38)
Location 22:47289609-47289631
Sequence GGAGCTGAAGTGGGGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184878353_1184878367 30 Left 1184878353 22:47289556-47289578 CCTCTGGGCTGTGGGCTGGTCTG No data
Right 1184878367 22:47289609-47289631 GGAGCTGAAGTGGGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184878367 Original CRISPR GGAGCTGAAGTGGGGAAGGT AGG Intergenic
No off target data available for this crispr